Description :
From Genome Similarity Track
Location :
contig_57:160126- 163794
Transcript NameFunction/comments
g8911.t1hypothetical protein

Sequence
3668 bases(100 bases per row)
TTGTGTTCTTGGGTTTCAGGCTTGAGTCTTCGGTCTTGAGGCTTGAGTTCTGCGGTGGTCTTTGGAGAATGCCAGCCAGGTCGGCACTGTCGGGTGTGAT
CATTTCCGCATTGGTGTACACAAACCGTACACAAACTGCATCCGAAACCCCGCGTAAACCGATAGATGACACATAAACGGGTCATATGTTTCGGCCTACT
CTGTGGACAAAACTGTGGACACCGTCGCTGGCCGCTCGTCGTCGCGGCGAGGAAGCACAGCTTAGTGGAGGTGGCAAATTTATTCTTGCAGAAGCGCTGC
GGCGCTCTGTTGGAGACCTGCACCACGCGTATTGATTGACAAGCGAGCTGCAGCCGTATCTCAGGATCGGTACGTAAACCCTGCGTCACAAATGGACACT
TTTGTGTCCATCTGTGGGAGGTTTTACTGTCGAGGTTTTTCAGTGTAATTGCTTTCGCCGTCCACTTCAACTTCCAATCCAAGCGCGGCAACTACATGCA
CAGGTAGCACGACAAAGGCCCTGGTGAACAATACTGGTGAGCACTAATCAAACAGGTCCCAATGGCGACTGCGGCAGAAGAATAGCCAGCTGGCAAGGCT
CAGCATCACATCGAATTAACACCGCTTGGCTCCGTCAAGGAGTGAAAGCTCGGTGTAGCTACAACTGAGCAGAGAGGGTCCATCCAGCACCAGCAAAATT
ATAGCTTCGCGCCAATATAACCCATGCTACCAGGCAGTTTGCGAGTGACGGTGGCCTCGATCCATTCTCGCAAAAAGCAACCGGTTGTCGTGCAACTTAA
ATCTGTGGCAACTTAACGAGCGGTACAGCGTACCGTATCTTTCGCCAGTTTCCGCCAATCAGCGTACTTAACCTAAACCTGTCGTGAAATGATCGCTCCG
TAAAACTGCCCGAGCAATAGTGGAACAGCGCTGCGGAGCTGGAACCCCGAGCAGCACGTGACGATGGCCAAGAAGGAGTTCCACAAGGTCTACAATGCGC
AGGCACGGCATAGCCGCCTGCCCACGCAGACGCAGATCCTCGTGGGCACGATGGGGTTGGCGGCGTTGCTGCTGGTGATGGAGCTGTCAATGCTGCGGGG
AAGCGGCATCGTGCCGGTCGACTACCTGCACGCGGAGACGGAGGAGGGCGAGAGCTTTTACCCAGACGAGATCCTCGAGTCTAAGTGGGCGGACGAGGTG
GATGAGGCCGATCTGGTGCACCTCAGTCTGCTGCACGAGGCCTGCCTCACCTACAAGGACAGCGTCGTGCCGTGGACGTATGGGCTGAAGGGTAAAGTGT
CCAAGCCCAGCGTCCTCATCGACAGGGACGACCCAAATCTGCTGGAGAAGATGCGACAGTGTCCAGATGTGGACATTTTCCTGCCGCTAGGCATCCGGGG
TCATGGATACTGTGAAGATTCCATTGCGTACACGAAATGTACGTTGTTAAAATCTAACATTTAATGCGCTTATGAGACTGGGGGGCTGTGGAGACTGATG
AAGATATGTTGTGTTGCTGTTTTTGCAGTTTTGGAGTCCCGACTGCTGCCGGCGTGGGCGATTGAGATGAAGTATGTGGACAAGGAAACGGGCGAGACGC
TCTCGTACCACGACTTGTGTCCAAAGACGCCCATGATCTTCCTAAACCACTACTGGGACGGCATCCCGGACTCGCCTGACTGGCCAGCAAGCAAACCCAT
GTACCTCATGCCGAATATCGAAATGTACGAGCTCAAGGCAGAACATTACTGGGGGGTGGACGTGGTGCTCTGCAAGACAGCGATCTGTGCGCGTGCGTGC
GGCTCTGGTACCAGCAGGAAGGTAACCCTCGTCACACGAAGGTACTCTACACGCGGCATACGTCGTCGGACGTCGCTATGCTGGCTAGAAACCGTTTGGG
GGACGACGCGATCAAGCCGAAGAATTGGTCGGACGTGCAGTTCATCCATGCGGTCGGCACCAGCGTGCAGAAGGGAACTAGACCCGTGCTTAATTGCTGG
ATTGGACGTCCTGACTTCCCCCGCTGCATGTGTACATGCATGAAGACGTGTACAGTGGAAACCTCAAGAGCCACTACGAAAACAAGATTAAGGACACACA
GGTGCACATGCACGTCGGCCGCGCCAGTGCTGACGACTTTGGCAAGATGATTGCCGAATCTGCATTCTTCATGTGCACGAGTCTGCAGGAGGCTATGGCC
ACTACATCAACCAGGCACGCGCTAGCGGTGCTGTGATCGTGTCCACCGACCTGCCGCCCATGAACGAGTTCTTGACTCCCGAGTCGGGTGTGCTGATCCC
TGTGGAGCGCTGGGCCTATCAGGAGCAGATGCTGGGCGGGAAATACAACGGAGAGCACGGCCTGAAGGGCGTAGAGGGGTTCACGGCCGACCTAGACGGC
CCTGGAGTGTGCAAGGCCGTGGAGAAGGTGCTGTCCATGACCCCAGTAGAGCGTGAGGCGATGGCGGCGCGAGCCAGGAAGCAGTACTTCATCGACCTGA
ATTTCTTCGCGTCCAAAATGAAGGAGCTGCGGGAAATTGCTCGCGGTGGGGAAGCGCCACGGCTTCGCTCGGAGGAGGACACCGTGTAGTGTACCATGCA
GATAATGTCGGTTGTAAGAATCCCGCATACGCAATGGCGGAAGGGTCTTGCGGCGCGGAGAATTAGGTAGAGGGTAAGAGAATGCTGCAAGCAAGAACTC
GTGTATCTACTGGGCTACGTCGTCCCTTGTTTCTGACAGGCTTCGCTCGCGCTGAGAGTGAAGTTATCTGTTGTCCCCCAATCGATCGATAGCTACCGAG
TCACCAAGTTGAAGCCAATACAGCTGTTGCGCGAGATGGATACTAAAGTGTCCATTTGAGGATCTAGAACAACGCTCTGGTCGTCGTCTACATGTGGCAG
ACCAATATAATTTACAGCGAGCTCTGCTGTATAGCTGCCGCATGCTGCTTCACCCGAGATCTTGCACGATAGAAAGCTGCTACATGTACGATAGCAATGG
CGAGTCGAGCGTCGTCAAAGTGACAATGTAATGATATACCTGTGTGCCACATCATATATATACTTGAAGTACAATATTACATGCACGTACTCCACCGGCT
TGTTTGCAGCCCCAGACCAGGACGCCATTCCACTTGGCGCTTCGACTGCGACTGCGACTGCGCCGTTCCTGGCTCGTGGTCGTTTTAGGCCTGGGAGTTT
TCGCTTTAGCTGTCGCCGAACGGATAGTGACATGTTTTTTTTGCAAGGGGGCCAGTTCTTTTCGCCACGTCGCTCCACCCAGCTGGCGGGCGCAGCCAAA
CTCATTTGGATTGAATATCCGACTCTCGAAAGCGGTGGTTAACAATGCCAGCGAGCGCAGTTTTCTCGAGGCTAGTGTCGCCGGCGGCACTGGGACTAAT
GGTGTCCATGCATGGATGCAGCATAAGCTCACTGCAGCAACAGCATCGATAACCGGCGTCCAGTTTCGTTCGAGGCGAGTTGCCCTACCCCTCGTCACCG
GGCACTTCTAGGAATCGTCGTGTTGCCGTTGAACATACAAAAGGCAAGTCACTCGGACGAGTCGGCGCCGCGTGTCCGGATCAAATCGCTCCGGGGCCGC
TCGTTCTGGAAGGATTCCGATACTCAAGCCAAGTGCGACCCCATTTTTCTCAAGGCTGGCCCGCGCCT