Description :
From Genome Similarity Track
Location :
contig_76:16010- 20021
Transcript NameFunction/comments
g12411.t1hypothetical protein

Sequence
4011 bases(100 bases per row)
CTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAGGAGAGCACCACAACTCAGTTGCGAAACTGGTAACCATTCTGGTTCT
TCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTGCGTTTATTCCAACGCAGATCCAGAATTTTCTCAACTTCAAACTCGT
CGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAATCATCATCCTCGTCCAACTCGATTGCTTCAACTGGACGTTTCGGGAA
CAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCCAGTGTTGGTGACTCTCAGCTTGACTCTGAAATCATCATGCATCTCA
TCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTCTGCACCTTGGGGATGTATAGCCATACAGCATCGCCAACCTTGAAAC
CGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGCGCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCACAGGCCTGGGC
GTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAACAACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACACCGTCCCTTGA
GCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAAGACGTGTTCAGGGCAAACATCAAACGTTCAGCGTGATCGTCCCAGT
CGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGACCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGATATGCTAGGGT
TGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGTAAAAACTTCACTCATGAACCTTGGATCCTGGTCATGCCTCAGCATTGAACTTGCTCCGAAAC
GCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAACTCATGGGCTTGCACATCACGTAGCCTGAAAATGAATCCTGAAACAG
GAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCATTGACACTAGCTCAAACGGGCGCTGAGGTTCGATATTTCCAGGTGAA
GGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTTGACAAAAATCTCCACATCAGCGAACATACCTGGCCAATAAAACTCTG
CACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCTCGTGCACATAGTGCAACATGTCTGGACGCAAGCTTTCAGGAACAAC
TAATCTCAGCTCAGACTCTCTGTTACGAGGGCGTCCCTTAGTTTCTGCAGCCAAGCGGTACAGCACTTCTCGTGAGTCCAGAACGTAGCAATCCGCATAC
TTGGCAAGTTTCTTGACCTCAGATCGGGAAAATTCATCCAACTCGCCTTTCAGATAGCTTTTTATCCGCTTGAAGAAAGCGTCACCATCTTGATGAGCCT
TGATTCGGCGCCAACGTTCTGCCTGATACTGCAGTGGTTCCAAAGGTTCAGCTGATACTGATCGCTCGACCTGAGATCGCGTAAATGCTGCTAGAACCTT
GGCCGCAGGAGGAAGAGGACTTGATTCAGATTCAAACTTCAAATCTTTATCTCCAGTCAGAGTCTCAGTCGGTTTCATGACTTGCTCAGGGATCTTTGAT
ACCAATTGCAGATGGAGTCGTTCATCTTCGTCCTCAACTCGCCAAGACTCACCCAACATCAATGTTTTAGACGTCAGATAATCTGCTGCTTGATTGTAGA
AGCGCTTGACGTGTACCAGTTGAACTGACTTGAACTTGGCTTTGAGAGCTTCGTATTCGGCAAGTCGGCGCTGAAGGTTCGGAGTATTACAATTTATCAG
GCCCTGAGCTTGCTGAATCACAATTCTTGAATCACCAACTGCAACCAGGTTCTCAACGTTGCGAGACAATGCCAGTTTCAGGCCATTTATTAGCCCATGA
TACTCAGCATCATTCACAGTGACATCCTCCAAGATAAATCCTTGCGCATCCACTACTTCCCAGCCGGGCAGCTGCCACAAAACGCATCCACAGCTGCCTT
GACGTGTTGACGTCTTAGCCGCACCATCGAAGCTCAGCACAATACCTTCATACTCAGCATCAAGCATTTCCACACTAACCGCAGGTTGTTGTTTAACATG
TCCTTTGGCCGGTATCAATTCTTCTACCACAGCATCCAATTGTTCTCTCGGCGTGATACTCGCACTCAGAATAGCAGCTAAACCATCTTCATCTCGCTGA
ACCTTGTGTATTTCAAGCGACCATCGCGATAACTCCAACCCCCACTTCAGGTGTTTTCCTTCAGTTGAGCTTGAAGCTAACAACCATTTCAGGACCGAGT
ACCGTGTATAAATCTTCAGTGGAAAACCCGTCCCAAATATGAGTGGTCGGAACAGCTGCAGCACTCTGAGAATCGCTAACACCTCCTTTTCAGGAAGCTG
ATACCGTATTTCAGACTCGTTCAGTATTCTCCCAGTGAAGCGCACAGGTTGGATCTTGCCATCGTGCATCTGGCCTAGTACAGCACATGCCGCCCAGGGA
TTCGCATGAGGAATGATGATAAACGGCTTGGTCCGATCTGGATGTCGTAGCATAGGTGTCGACACAATTTTACGTTTCAGGATCTCAAACGCCGCTTTTG
CACGTTCAAGGTCTCGCCCGCTCTCACTTGTTCTTCGTTCAACTCATACAGCACAGCAGCCACCACAGGCAAGTCTTCAATGAACTTGTGGTAATAGTTC
AAGCTTCCTAGGAAAGACTGAACTCCCTTCAACGTAGACGGAAACGGCAACTCCTGGACAGACTTCACAATCTTGGGTGTAGCTCGGATTCCTTCAGCGC
TGATTTCATGTGACAGATACGGGATGCTCAACTTGCCAAACTCACTTTTCGGAAGGCTCACTGAGATGTTCCAATACCGCAATCTGAACAAAAGCGCGTT
CAAGTCATCACACAATACATTCCAGGTTGGAGCACCATGTGCGATGTCATCAATATATGAGCTACGCCCAAGCACTGGACCCATCTGAGGAGGAGCCGGT
ATGTTACGTTTGAACACAGTCATCTGCTCCGTAAGAATTGGTAGTTCAACCTTGTCAAGTTCAGGACCTTCAGCACATGTGCGTTCAGGATCCTGAATCT
TGTCCCGTTCAGCACTTGGAACGTTCAGGTTCAAAAACTGCAACACTTCTTGGTCAACCAAAGCTTCCTCTTCTGGAGGCAGGCGCACAAAACCCCACAA
GCAATTGTTAATCACAGCTTGTACACTAGAGGTGCATTCTTGAGTCCGAAGGGCATTCGTATCCATTGAAAGTGTCCAAAAGGGCAAATGAACGCTGAGA
TCAATTTCGCGCGCTCAGTCATGAGTACAGCCCAGAAACCACTAGCCATGTCGAGACTCATAAACCACATCGCAGATTCAAAACCAATCAACAAATCATC
GATCAGTGGCAGAGGGTATCGCGACAGCTTGATGAATTCGTTCACCAGGCGATAATCAATACACATCCTGATGTCCACTCCATTTTTCTTGAGAACAATC
ACGATGGCGAAGCCCATTCTGACTCGGAATGCTCAATCAGACCCGTTTCAAGGAGTTTCTTGAGCAACTCGTACACCTTGATCGACAGATGTGGCGCAAC
TTGACGTGCACGTTGAGACACTGGGCGTGCATCTCCTACATCCAGATCACACACAACACCTCGCGCTGGAGCTGGAGCCGCATTTCCGTCTCCCAGAAAG
ATCTTCCGATGTCGTTTCAGGATTTCCCTCATCTTCATTTCCATCTCTGTAGTCGTGACTCCTGAGACGCCAACATCCGCATCTTCGATCTTGCATTCAG
GGCTCAAATCT