Description :
From Genome Similarity Track
Location :
contig_76:16009- 17438
Transcript NameFunction/comments
g10059.t1hypothetical protein

Sequence
1429 bases(100 bases per row)
TCATCTCCTGCCTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAGGAGAGCACCACAACTCAGTTGCGAAACTGGTAACC
ATTCTGGTTCTTCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTGCGTTTATTCCAACGCAGATCCAGAATTTTCTCAAC
TTCAAACTCGTCGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAATCATCATCCTCGTCCAACTCGATTGCTTCAACTGGA
CGTTTCGGGAACAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCCAGTGTTGGTGACTCTCAGCTTGACTCTGAAATCAT
CATGCATCTCATCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTCTGCACCTTGGGGATGTATAGCCATACAGCATCGCC
AACCTTGAAACCGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGCGCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCA
CAGGCCTGGGCGTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAACAACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACA
CCGTCCCTTGAGCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAAGACGTGTTCAGGGCAAACATCAAACGTTCAGCGTG
ATCGTCCCAGTCGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGACCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGA
TATGCTAGGGTTGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGTAAAAACTTCACTCATGAACCTTGGATCCTGGTCATGCCTCAGCATTGAACT
TGCTCCGAAACGCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAACTCATGGGCTTGCACATCACGTAGCCTGAAAATGAA
TCCTGAAACAGGAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCATTGACACTAGCTCAAACGGGCGCTGAGGTTCGATAT
TTCCAGGTGAAGGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTTGACAAAAATCTCCACATCAGCGAACATACCTGGCCA
ATAAAACTCTGCACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCTCGTGCACATAGTGCAACATGTCTGGACGCAAGCTT
TCAGGAACAACTAATCTCAGCTCAGACTC