Description :
From Genome Similarity Track
Location :
contig_66:160041- 161537
Transcript NameFunction/comments
g11311.t1hypothetical protein

Sequence
1496 bases(100 bases per row)
TAACTTGACGAACAATGGCGGGTGCCAAAAGCAAACGCAACTTCAACTTTCCTGCTCTTATAGAGAGTTTTTCTTGTAGAGGACCAGAGTCCCGAATTTT
GATTCGGATTTTGATTATTTTGGGTGGTTACCCTGGACTCCCCCATAGTGAGTTCGAGTCTGACAGAGCCCGAGGAATCGCCGTGGCGTAACCGGGTACA
GTCTTCAGGTCAAGCGGCTTCAAGCTTCGCGCGCTCGTCGGAGCCAGATCTCCCTGCCGCCATGGTGGGCAACAAGCACAAGAACGGCATCATCTGCACG
TTCCCGGACTGCAACAGGCCCATGCGCACGCAGAAGTTTAAGATGCACTTCTCCAAGAAGCACCTGAAGGAAGGCGAGGTCTACTCGGTGGAGCATCGGC
GCCAGTACGAGGTGGCGAGGGAGGACAATGTCCGTACTATCGTGAAGCATGAACTTATCCCCGCCACCGCTACCACTGCAGCACCGATGCTGTCGTCGGT
GGAAGAGGTTTCTCGCACGGAGACCACGAACGCATCGGTGATCTCAACTGCTGCTGTTGCTGCTGCACACGAGGCAATCCAGACTCAGGCGAAGGAGCTC
GCCCTGCTTCAGTCACAGCAGACACAGCTTGCCTCGCACTACGTAGCCTCTGATGTCAAGACGGAAGAAGCCGGTGACGCAGTGTCGCCGCCTGTCTCCG
CCAACACGGCTTCCGTGTTGTCAGCAACCTCTGCTGAACAAACTAGCGGCAGCAAACGCCTGGCGTCGGCAATGGAAACCTCCCAAGGCGCCATCGATCC
AACAAGCGCGTTGCTGATGCAGTTCATAGCGCTGATGGACCAGCGGTTCCAGGAGCTTGTAGGCAAGATGGGCGAAATGATCGACGTGCAGAAGGATCTA
ATCGATACACTTCAAGCCAGCAACCCGAACGGACAGGCCCCAGCGTCAGCTTTCTCGTCCGCCGTCGAAGTGATCATGAAGAGACGGAAAACAGAAATGA
GCCCTAGCGGCAATGAAAATGGCAAAGCCGAGACCAATGTCGAGACCCAAGGACTTGGTAACAACGGTGTCGTCTTGTAGACAGCGTGACGAGAATTGAC
TTCCTTGATATAACCTTTACCTCGCATCAAAGTTGCGCTCCCAATGTCAAAGTAGCTCAAGGTAATGAAACCCAATTTACTCAATGTCAAAGTATGTCAA
AGTAGCCATTTCGTCGACTGTCAATGTAGCCATTTCGTCGACTGGTCGTGGTGTGCACCACACCTCGCCGTCTTCCAACCAATTCGCGCTAACAAGCAAA
AAGAATGAGTGAGCAAGCGGTGGAAGCGTTCGGCAGCGTGGAGCAGACGCTGGCGGCGGTAGAGGAGCATCTGGCCGTATTCAAGCAGACCTCAATGGAG
GACTTTGTGGCCCCATTGAGCCCACTGGAGCGTGCGAAGGTGCAGGTCTCGTTGGGTACGTGCGGCAAAATTTTCGTCTCGCTTCGTTGATCGAAT