Description :
From Genome Similarity Track
Location :
Scaffold_4:1600336- 1607440
Transcript NameFunction/comments
Phyin_T30-4PITG_03401Chromodomain-helicase-DNA-binding protein%2C putative

Sequence
7104 bases(100 bases per row)
TCCACCAGTCAACAGGATGTAGCTCTCGCAACGACGCCCGCTCTCGTTGGCACTCTCGAGCAAAAGATTACAGTCACTGGGCCCGAATTAAGCCCTGCCC
ACGCTGGTAACAATGCAGTGAAAACCGACGTGAAGACTGAGAGTCCAACAAAGAGCGAGGACAGTGATAAACGCCGCAAGCGCCGGGCAAACAAGAAAAT
AAAGTACGTGGAGGAGGACGACATCTCAGAGGGTGAAGAAGCCATGATTGCAGACAAGAAGAAACGTGCACAGCAACTTGATTATCAATTGAGAGCGGTA
CGTAAGCTATTAAGGCTTCGGCTGCGACTTGAGGTGGGTAAATGTACTGATTTTGGGTTGTATAGGACGCGGGCTACCCGCAATTGGATCAGATTGTCGG
ACGACGGACCAATGATTCGTCGGGACTCGTCGAATATTTGTGCAAGTTCCTCGGTCGGTCGTATCTGCACCTGTACTGGCTCACGTTCGACGAATTGGAG
CTTTTTATTCCTGAGGGATACCAGAAGTTTCACCGTGTGCACGTGTACGATCGTAAGCTACGTCGCGAGGGATACCAACCACTGGATGAGGTGGACGATC
TGGAGGCCAATAAACTGACTGTGGAGAAGATATTGAACCACAAGGTGGACCCAGCCGACCATTTGGACGAGCAGATCGAAAAACGGCGACGTCAACTCAA
GTACGAGCCCAAATTCCCACGTGTGACCGACTATTTCTTGATGAATAATGCCGATATCATTCAGGAGCGAATGCAGGGAATCGTGACAAAGCTGACGAAA
GAAATGGGAGGCGACATCTTTGAGCACCCTGTCGATGTTGAAGAGGTTCCTGACTACCTCAACTTCATCACGAATCCGATGGACCTTGGAACAATTTCCA
CACGACTTGGTCGAGAAAGTTACTACATTGGACCGTCGGCCGTGTCACTATTTGCCTCGGATGTTCGACTGGTGTTTCAAAACTGCAAGACGTACAATGC
TGAGGGATCTGACATCTGGCGCGTTGCTGCTGAGTTGTTGCGCACATTCGAGAAGTGGATCTATGACTGGATATTATCCCCGTCTGCGTGGCTAAAGTTG
CCTCCTTCAGGAGACGCAGAGGAAGACCAACGCCTTCAGAAAGAGTTTCGTGATGAAGCAGAAGCATTTTACGATCTGTGGGCACCTTATCGGATCGGCT
GTTGCATATGTGGAAACAGCAATAACAGTGAGGAGCTTCTGCTATGTGACCGATGCGATGGTGAGGTTCATATGCATTGTGCTACCCCGAACGTCACGGA
ATTACCGGAAGGTGAGTGGTTCTGTGGATACTGCCGAGTGCGTAAGAAATTTACTGGAAAGATGGAGAAAGCAAAGGAGGAGTCCGAACACAAATTGAAG
AGCATCGAGATAGAAGCATCCACGGGAGTGACGACTCCTTCAGCTTCTGGCTCAACCCCAACACAGGCAGACAAGAAAGCAACTACTACGTCTACGCACG
CCCCGAATATCCTTATGGAGCGAGCCGATGGTGAAGGTAAAGTTAACAAGAAAACGTCAAAGCGCAGCCCTAAAGGGATCAGCGCGACGAAGAGCTTGGC
GCCAATCAGTATGAAAGATCGTGCTGGTACCTTTTTCCTTGTCAAGTGGATGGGTTTGTCGGTTCGATTTTCGACGTGGGAGCGTCCGGAGGATATCGGA
GACGATGAGCAAATCCAGAGGTATTTCAAGTTCAGTCGTGTGCCTAGCGCGAAGGAGATCCGTGAGACTACGTGCCAATTGCCGTGCTGTGCTAAGCGAC
ACCAATACGCACTAGTAACAGCCACGAGCGGGAAAAGGTGCTGTGAAAAAGATCGTTTCTGTACTCTAGGCAACGGCCACGAGGGTAATTGCAGTCGTAG
CATTAAAGCAGTTGGAGGAGCCTACGGCAGCATTGCGTATCAACGACTCCACATGCAAGAGCAAGTAAAGGCACAACTGTTCGCCTTTCACTGTTTGCTC
AACAATCATACGCCCGACAAGGATGTGCTCAAGCAGTGTGGAATGCACACCAACGCGTACGTGACTACGAAACAGCACTTAGCACCCAAGGCCTTAAAAG
AGGACGACGATGAAGATTATTCGGATGAGGACGGGGACTCGTCTGATGACGATGCAGACTTTGACGCCGAGACTGATTTTCTGAATCGACCAGCTTTCTA
TCCTGGAATCTTGACGCTGGAAAATGACGACGAAGAGAACGATGACGAAGCTGGAGGCCACAAGAAAAAAACGGAAGAAGAGGTCGGTGAGGTACTGAGC
TCTATCGTTGAGCACGTTGCGCTTGGATACCCCACGAAGCTCGAGACTGTCAGTGCTGAGTTTCGATTTGACTCGATATACCCCGCATCAGCTTTCAATG
AGCTCCCAGCCTTCACGGAGTACTGCATTATTCTGGGTCGATCGCCCCTCGGTTTGGGCATGCGTCTTGGAATCAGTTGCACCACCAATGTCTCGGTTCT
GGGTTTCCAACCTCTTGCGAATGGCATGATAGGTCCAGCGCAGGCGTCTGGAGCTATTTCGATTGGTGACGTGCTTGTAGCCGTCAACAAGATATCGGTG
GCAGGTCGTTCGTTTCAAGACGTCGTCACGCTGATTGGTGCTTCTTCCCACCAGGTTCTTTTCCACTTTCATTCTCCCCGACCAGCGTTCATGTACCCTC
CGTACTGCCAAGCAAAGCAGGTTACGAAGCTTCGGTTGGAAAAGATTCCTGATGATGCGGCACCTGAAGGCTCAAAGTACGCGCAATACAGCTACAATCA
GTTCAAGCGAATGCTCAAAGTGGGAGTTGCGGAGCCAGATGTGGCATCGGCAGCTTCGACACAGACGCTGATGCAACACGCCAACTATAGTGCACCAAGT
GGCCCCATGCAACATCTGTACGCTGGGGTCGTTGACAACAGCATCGACCCACACGAGCACTTTGCTAGCTTCCTCCCTGAGCGGAGCAACGCAGCCAATA
GTGGATCACACGCTAAGAGTGCGGGCTCAAGTGGAGATGCGAACGAGTTTGTTCCGTACGAGCAGTCACCAACGTACAAAGGAGGCCGCACGCTGCGTGC
GTATCAGGTTGAAGGTCTCAATTGGATGGTTTCGTGCATCAAGGCCCAGCGGTCGTGCATTTTGGCTGACGAGATGGGACTGGGTAAGACGGTTCAGATT
GTGTCTCTGATCGAACACATGAAGTCGGAGGAGTCCATTCGAGGGCCTTACTTGATTGTCGTGCCTCTTTCTACGATCCAACATTGGCGACGTGAAATAG
AAAGTTGGACGGATCTCAATGTGTGCGTGTATCACGATATCGGTGACCGGTCTACTAAGTTTACGGCTAAGGACATGCGAGCCGTCGTCCGAGACCAGGA
ATGGTATTATCCGGGCTTGGGCAACTCCATCTTCAAGTTCCACATCTTGCTGACTACGTTCGAGACCATTTTGGCGGATTTCGAAGAGTTTGAGCACATT
CACTGGCGCTTAGTTGTGGTGGATGAGGCTCACCGATTGAAGAGTGCCGGGTCACGCGTGCTTAAGATGATGCGCGTCCTTCACGTTGATCGGAAGGTAT
TGCTGACGGGCACGCCTTTGCAAAACAACACGCAGGAGCTATGGGTCTTACTAAATTACCTGGAGCCAGTCAAGTTTGCGAGCTTGGAGGAGTTTAACCA
GAACTTCGGAAAGCTTCATTCGCAGGAACAAGTCGTGAGGTTGCAGCAGTTGCTCGCACCGTTTATTTTGCGTCGAGTGAAGGAGGACGTTGAGAAAAGT
ATTCCTCCGAAGGAAGAAACGATCGTCTCTGTGGAACTTACGACGCTGCAGAAGCAGTACTACCGAGCCATTTACGACAAGAACAAGAGCTTTCTGTATC
GCGGCACAAAGAATGGGTTGCCGACGCTGAATAATATTCAGCTGCAACTGCGAAAATGCTGTAACCACCCGTTCCTGATCAAGGGCGTGGAGGAGCGCGA
GCTGGACGAACTTGGCAGCAACCCCACACCTGCTCAAGTGATGGAGAAAACGATCGAGTGCTCAGGCAAGATGATGCTGGTGTCCAAACTGATCCCGAAG
CTTAAACGGGACGGTCACAAAATTCTGATTTTTAGCCAGTTTCTCAAGCAACTGGACTTGCTGGAACGTTATTGCGAGGCAAATTCTTTTGTGTTTGAGC
GTCTGGACGGCTCTACTGGTGGAAGCGTGCGGCAGAGCGCGATCGATCGATTTTCTAGACCCCACTCGAAGTCGTTCATTTTCCTGCTGAGTACGAAAGC
TGGTGGCGTGGGCATCAATCTCATTGCAGCTGATACGGTGATTATCTTCGACAGTGATTGGAACCCGATGAATGATCTGCAGGCCCAGTCACGCTGCCAT
CGCATTGGGCAGAAAAAGAGTGTTCAAATTTATCGTCTAGTGACCCGCAACACGTATGAAAGCGAAATGTTCGACCGCGCCTCACGAAAACTTGGGCTTG
AACACGCGGTGTTAGGCACGGCGTCATTTAACGAGAACTCTCAGATCACCAAGCCGTCGGCAGAACAACTTGTGGAGCTGTTGAAGCGTGGAGCGTATGC
GCTTATGGAGGACGATGATACGGCGTCGAAGGAGTTTGCTGAACGGGATATTGAGACTATCTTGAAGGAAAACGCTCGTGTTTTGGTTGTAGGCGGCAGC
TCCAATGCTAGCAAGAGCGCTGATGGCGATACGGGCGGAATCGCATCACCAAAGCAGAAAAAGTCGCCCTTGAAGTCTAACAAGAGAAAGTCGCTGGGCG
GAATGGCAATTGACCGTTCCTCCTTCGTGGCCGAGGGGTCGACGGGTGAACTATCCGTGGATGATCCGAATTTCTGGGAGAAGGTTCTTCCGGGAGCTGT
GTCGGTGGAAATGCTCAGTTTGAAGCTGGAAGATGGCAGTGCTGTAAACTCGCGCCAGTCGAAGATCAAGTTTATCAGCAACTTGGATATTGCTCTGACG
AGCTTGGTGGCTGAGATGAGTTCAGGCAACAGTTCTGACGATGGTCGACATGGCAGTCGCGACATTCAGCACGAGTACGACATTGCTATCCAGGTATTGA
ACACTGTGAGCTCGAAGTATCGTGACGAGTTCTCCAACGACCAGATCGATCTCGTGAAAGGATACCTGACAAAACTGGAAAAGTCACGTGTGCGAAGCTG
TCGACTAGCCCCTGCGCGAACGAACTTGTTCCAGGATGAAGACTTTGATACGCCGAAGAAGAAAAGGAGAAGGAGAAGCACCCCTGCAGGCAGCAGGGCT
GGGAGTGAAGATGAAGCGTATGGCAACACTCCGGTAAAGAAAAGAGGACGCGGTCGCCCTCCAAAACACCCAAGAACTGAAGACGCGAACCCCCCAATCG
CCTTGTTCCAAGGTGGCATTATTAACGAGACTGACGATTTGTGCACTCTTTGCGGCGACGGTGGGCTGATCTTGCTGTGTGATGGTCCGTGTCATCGTTC
ATTCCACCTCGACTGTGTGGGCATGAAAGACGAGCCCAACGACGAGCAGTGGCTGTGTCCAGATTGCGCTGAGGGTCGTCATATGTGCTTGATTTGCAAG
CAGGTGGGTGAAATGGGCGTTGAGTTTGGTGTCACGCAGTGCTCCGTAGCCAAATGTGGCAGATTCTACCATAAGGGTTGCCTGGCAGAGAACTCGCGTG
TCGAGTGGGTTGGCAAGAAGCGCTTCCGTTGCCCGAGCCACTTTTGTCATGCCTGCTCGAAGCAAGCTACGACCAATAGCAACAAGAAAGGTGAAGACAA
TACTGGTTTAGTGAGCTGTATCCACTGCTCACAAGCCTTCCACCCAGACTGCATTCCGTCAGCCGACAAATTTATTCGACTATCGAAGAACCTCATGATT
TGCGCGAATCATGTAGACGGGAAGAAGGCTCCAGGGAAAATTAGTGCACGCGCATCTGGATCAGCACCGGCTGCACAACGTGCTGGAGCTGTCCTTGCTG
CGGCCTCAACCCAACTAGAGATCCCGCAACATATTCCGTTAGAAGAAGACGAAGCAGAACAACCGGAAAAGTCGAGTGGTAAGCGCAAGCGCGAGCCATC
TCCCAAAAGACCAAGCTCGAGTGGGTCGAAGAAGAGCAAACCAGCCCAACCGACCAACAGGATCGCGAGGCAGAAGGTCTGCGCTCTTTGTCACCGCGGA
GACGTGATGGGAGGGGGTGCTGCTAGCCAAGATTTGCCACCCCCATCTTCAGCCAAACAGGGAGCAGACTCGACAGGGACTGACACTGCAGATATGGCTC
TGGAAGGGCCTTTTATTGAGGCTCCTGTGCGCTTGAAGTACACTGACAGGCCCAACGAGTCTGTGCATGTGCACTTGAACTGCGCCGTACACTCGCCAGA
AGTGTACGTGAAGGCTGATGGTCTGATCATGAACTTGCCCAAGGCAATTAAGCGCGGCCGACAGCTCAAGTGTACCAGTTGCCACAAGTTTGGAGCCACG
GTGGGCTGTGTTGTAGCCAAGTGTCGGCGCAATTACCATCTACGTTGTGCAGTGGAAAGCGGTGGAGAGATTGACGGAACCACGTACGCGTTGTACTGCA
AGCCGCATGCTGCTGCTCGCAAGGAACCGACCCGTGTCTGCGTGTGCGATACCAATGAAGAAGACCCGAAACTCACGTTGGTCTGCTCGTCGTGCGACAC
AAAGTTTCATCCGAAGTGCGTCAACATGTCGGAGCGACATGCGGCGCGTATGGCGAAGACGTGGATCTGCGGTGTGTGCGATGGCTCAGCTGCGGCGAAA
CCTGCGATCCCAACACACATGCCTGCGAAAGCAACGTCGAATAAACCGGCGCCGAAGAGTAAGTCAAGTAGCTCGAAGGATCCCGCCAAGAAGACAACGA
AGGCGTCAAAGAAGAAGAGCAACGAGAAAGCGGAAAGTGCTGATGCTAGTCCGCCGAAGCGCAAGAAAGTGAAGAAGAACCGCTTGAGCATGCCACGGAA
TAAAATCCGCTCGAAAGCGAACGGGACGAACCACGGTATCTCACCGCACATGGCCGACTCAGATAGCGGTGTCTCCACGGACGAGTAGGTAGAGAAAATA
CAAA