Description :
From Genome Similarity Track
Location :
Scaffold_603:16003- 18265
Transcript NameFunction/comments
Phyag_g6956hypothetical protein

Sequence
2262 bases(100 bases per row)
TAGGGACGTACCAACAGTCGTTGATGAAGCTCCGCTTTAGGCAATGCTTGTCATCGAAGCTAGCTCCCTAAAAATACGGTGTTGGCGGGACAAAATTGGA
CATGATGAGCTTGGTTCCGAGAATTGAAGGTCTATCTCCACATCACCACTGGGCTTAGAAGTCTGCATCACATCACCGAAGACGATAAATTATCGCTTCA
ACCGTGGAGTTGATGATGTCTCCAGGACATGGCAGCAGAAATGGCGAGCTGACGAGGACTCCGAGCGAAATAATAATACGAAgtgatgttgaagatgacg
aggcTATCACTCTGGATAATTTTGACGAGACCGATGCCATGGCAGACCCCATTCTCAACAGCCCGCGCTCGATTGAGGTACGGACATCTCAATGGTTTAT
TGTAGACTTCATCGACTAACAATATCGTGTTAGGCCTGTCGGATGCTCGGTGTCGAGCCTGAAGAGCTCATTCTACGGCCACTTGAGTGCTTTATCCGCA
CCTCGAAAGGAGAACGCTCAGAGGACCGTGAATTTGTCGCTAAACGAGCTGCAAGGTACGAGAAGAATCGTCAAGTTCAGCTTCGAAATGTGCGTGCACA
GCGCTACGAGCTGATTGAGGCACAGTTGAGAGGCGTGCACGGCAGTATGTCCCTGAGGACGCGTAGTTACTGTCGATCTCCGGTGGGGGCTGCCCGACTT
GGTTTTGCTGTAACAGCCGGTTGCTCAAGTTCACAGAATGACTTTACGGTGATTGAACGGGAGAAGAGAGAATTGGAGCGgattcagcagcgccaagcac
TCGAAATGCAGCAAATGTTCAATTTTGAGCTCAGGATGGCGAAACTGTCTCAGGAGCGTGAGAGGAAGGAGCGTGAACAAAagcgacgagaagagctTTT
TACGAAGGAACGTTTACGAAgacaacgagaagctgaTGAGCAGAAGCGTAAAAAGGAGATCGAAAAGACGCAACACCATCGccaagagctcgagctggCA
CGAAAACAAGCCCAGGAGCAGCAAATGGAGGCTATGCGGCGTGAGCAGCGCGCtaagcaagaagaagcccgtAGACAGCGTGATGCCCAACTTAGTGAAA
AAGAGCGTCTacgccatcaagaagaagcgcggaTGCAGAGTGAACTCTATCAACTTGCCCAGGAACGAGAGGCGACTAGAAAATTGAAGGAGATGCAAGA
TCGTGAAGATCGCTTGATGCAGGAGCGAGAGATTCAGAGGCAAGCTAAAGCACGCGAACTCGCCGAAAAACAGGCACGGAATACTGCGCGTATTGCAAAT
GTCCTGCAAGAAAAGGATTTGCAACGTAAAGCCCAACTCGAGGAAGCGGCtcgcaagcagcaacaaagtGAAGAACGTCGCCAAGTCTTTGAGGAAGAAC
GAAGGGCtaaagaggaggagattcGACTTCAAGCACTACGCAAAAAGGAGACGATTGAAAACGTTCAAACCCAGTTGGCGTTGATCGAGGAAGATCGTCG
TGAGCGCCTacgagaacaagaacgtCAAGCTCAGCTGCGACTAGCGCAACGCGAAcgcgagaagcagcaacaacttgaagCCCAACAGCGTGAGGAGCGA
CGGTTAGAGCGTGAACGTCGTCGCGCGTTTGAACGCATGGAAGACCAACTGCACAAGAAACAGTCGGCCATTCTGCGCAAGGCGGAGGAGAAAGCCATGG
TGGCTCAAATGATGCAGAAACAGAAGCATGCAACCGTGCGAGCTCGGCTGCTAGACGCGAAAttacgcgaagaagaaattcaaTCCGCTCTCATgcgcaa
gaacaagatggaCGAATACCGCACAAACTTGCTGCTTTCTCGCATCGAGACTGATGACCAGCGTActcagcagctcaaagcaCAGCGAGCTAACCTTATt
cgtcgccgccagcagATCAAGCAAACTGCCAGTCGCCAGAAACACGAGATCCTCGAGAGCTTCTACAAGATGAAAGTTACAAACAAGTTCCAGCTCCCCA
AGAATCTTGCAGCGAGTATTGTCGTGGAACGCCCGCGTTCGGCTTGGATGTTGCACACCCAGTCGTTCACGACAGTAGGTGATGCGCCTGCTAAAAGACC
TACAAGCGCTAGAGCAAGGCGTCCACGTAGTGCCGGCTCAACGTTGACCCGCCGTCCTATAACAAGTCGCGAACACAGGAGTCCGATAGTCGATGAGCCG
CCCAGTACCGACGCTGTGAaacaagctcaagacgcgTCAGATGGTGAaaaacgcgctgctgc