Description :
From Genome Similarity Track
Location :
Scaffold_541:16000- 19860
Transcript NameFunction/comments
Pytve_DAOMBR484snap-pve_contig_541-abinit-gene-0.32Ser/thr kinase

Sequence
3860 bases(100 bases per row)
GCAGCGACCAGAATGGCCTGCAGCAGTTGCGACGCGATCTCTTTCACCAGGATCATGCTGTTCTCGTCCTGGGCGAGCGCATGCACCATCGGATGGAGAT
TGTACTCGACGAGAAACTGGATCGGCGACGTATGCGACTCGAACAAGCTCTTGAGGATCTTGAGCAGGTTCTTGCGAACAATCGCTTTCGGCACGAGGCA
CAAGCGGCGTAGCACCTCCGTCACGAACAGTCCATTGCGTCCCAGCGACTGGTTGAGCGACACCGACCGCGTGATGATCTCCAACAGGGGTTCGAGCAAG
TTTTCAAGCTCCGAGTCCTGCGCGTTCTGGAAGCACGTGACCAGCTTCATCAAGTTGTCCGGCATCAGCAGCACGCCCTCCATCTTGATCGTGTCGTGTG
TCAACCACACGCTGATCGATTTGACAGCGTCCATCTGCCAGTACTTGTCCTCGAGCAGCTCCAAAAACAGCAAGGCGACATCGCACGCCCACAAATGCGC
TCGAGCAGTTGGCGACGCGTGCGCCAGGTCGCACAAGATCGGAAGCGCGAACTGTTTGAGCGGACTCCCGTCGCGAATCACCTTGATGAGCGAAGGGATG
ATGCCTGCTTGAGCTGCGTGCGTCTGGCGGTTGCGGTTGATGCGGCACAGATAGAACATCGATTGCAGCACAATGTTCTCGAGCTCGCGCTGCTTGGCGT
CTGAAGTTGCCGACGCTGCTTCACGATCCGCTTCCTGGTCGTTCAGCAACCGAACCAAGGTTGGTATCGTGCCCGCGCGATCCAGCTTCTCCAGCGTCAG
CGGGTCCATGGTCAGGTTACGAATGCACTTCAGCACCTTGATCATCGCTGTGACAAACTCGTTCGAGTGATTCAGCAGCGACACGGTGGCGCGTTCGCTC
ATCGTCCCGTCGTCAGTGAGAGACTGTGTCACTGGGTGAAGTGCCTTGAGAAGACCTTCCAGTACAGCACCATCGCACATGTGCTCCTTCACGACGGCAT
CGCCCTGGGAAAAGAGCAGCAAAATATCGCAGAAGTTGTTGAGTTCAGCGACGCTCCAGTCGCCCTCGTTGTTGCTTCCTGGTGACGGCACGCCAGCTGC
GCGGGTATTTCCGCTACTGCAGACTTCTGAAGCGCTGACGGATAGCACGATCTCATTGAAGACGGAGACGAACTTGCGTAACAGGCCCGCCTTGACAAAC
AGCCGGCAAATGTCGTTCTTGGGGATCGTCTGTAGGTTGAACACGCTCATCGTCCCGTCCAAAGCGATGCGCACCAGTTCGATCTCCGAGTTCTTCCCAT
CCGGCGACGCATCCCGTTCCAGTGCGAAGAAATCTACCAACACTGGAAGTCCGCCACACGCAACGAACATCTGCAGCGTCAGTGGACTCGTCTTGCAGCT
CTGTCGAACGAACTTGGCAGCCTCGAGCCGCACTGCCGTCGAACTCTCCAGGTCTCCCAACGGAGTGTGTTCGTGTTGCGCCTCCCACTCATCGTCGTCC
GCGGCGTAGATGGGGTTGTGTTCCTTCGTTAGCTTGATAACCACTGGGATCAAACCCACGAGTGCGAGGTTCTCCTGGAACTTTTGGTTGTCTTCCACAA
TCTGAGTTTCCAGAATATTCCGATAAGTACAACGGACAGCCAGGTGTTGCAGTAAGAGATGTGCTTACCGTGTTAACGACCTTGAGCACCGCGTGCAACA
CCTCCGCTTTCTTCATCTCGAGTGCCTCCATTATGTTCGGCACCACGCCAGGCTGGGACATGAGGTCGCGTCGAAGCGATACATTCGTGAGAAAGATCTC
CTCCTGCGTTTCAACACCAGCGTCCCGAGTTTGTCAAGCCACTGGGTCGTTAAGACCAGGCACATCCATCCAAATGCAGTGCTCACTCACCAGACTCGAG
CAGGCCTCTAGAATGACCTGATCGTCCATACTTGGATCCAGCAGCGCTAACAGCTCCATCACACGTGCTGTGATCTTGAGGTTCGTGTCGCGTATGGTCG
AGTAGTCGAAGTCAAGCTCGTCTCCGAAGATATTCTCCGGCTGCGAGCTGCTCGCCGACGATTCCGAGTCCCTGATCGTGTGAGACGACGTCGCGGTCCG
CAAGACTAACCCTCCATCTGCTGGCAGCACGATCCCCGATTCAAACCCAGCTGCGTCATCGTCGTCGTCGTCTCGGAATCGGTTGAGTGCGACAGACGAA
TTGATTCGCCGCATCTCCTGCTGCTTCCTTTCGGCAGCCTTAACGAGTTCTGCTTCGTCGAGATCGTCAAACCCCCACCTGTCATCGTCCTTCTCCACGA
ACTCCTGCAGCTTCGCGATGCGTTTGGTTTTGGGCACAAGCGACGAGCGATCCCACGATCGCGACGCGCGCTCGTCACTCGAATCAGGACCCCGTACAGG
AGCTGAAGCCGATGCTTGTGACTCTCCTTTCCGCTGTTGCACTGAAGGCGCCAGTTGCATGGGCTCTGACTCGTCGCCGTCATCCCACAGCTCGTCGCCA
AGCAGTGCGTTCGCATCTTCCTTCGATAGCTTGAACACATTCTGAGGCGCTTGGAGCTTCAGCTTGGATGGAGTCGCCACGGCCGTTGAGCCTCCAGCTG
GAGCGATTGGAGCCAGTGACAGCGGGGCAGGCGACGACTGGACGCCGAACTCGTCGTCCCAGTTCTCCACCTCCTCCTCATCTTCGACTTGCTCCATTAC
GCGAGACGGACGAACCTCTGTCTTGGTCGATGCGGCGCTAGTTGGAGCGCTAGAACTTGTCCCATCTGTCGCCGACGAGCTCTTTTCGTACATCTTGATG
GTGTTCAGCACTGCGTCGCGGTCGTTCCGGGACGTGACGTTCTCGGCGATCAGCTGCGTGCTCTGCTCAACCTTGTTCTTGGGGATCTGTGCAATCCACG
GGTGCTGCAGCAACTCTATCGCCGAGCTGCGCAGCCGCGGCTCCTTCATGAAGCACTTCATGATAAAGTCGTGCAGCGCCTACCGCCCAACAGCTAGTTC
AGTCATCGTGACGTGATTCAAGGCATTCCCACCAAACGTACTGGTGAGATCCGCTCCGGCAGCGGCGGATGGTCGTCCTGCACGATCCGAAAGAGCGCAG
CCATGGCCGTCAGCTCAAAGTACGGCGGCTTCGTCGACAGCAACTCGATGATGGTGCAGCCGACGCTCCAGATGTCCGACGCCGTGGACCACCCTGCCAT
CTCGATCACCTCGGGAGCCACTAGTTCACACATGAATAGCATAGCGTCTGTAAGCTCACGGCTGAGCGAAAGATGCAAGGCGATACAACGCACTCCAGTA
TGGCGAACCGACGACGTCGTCAGCCTTTTGCGTCTCGCTGAGCTTGATGGCCACGCCAAAGTCAGCGAGCTTGACGAGACCGTCCTTGGTGGTGAGGATG
TTGGCCCCCTTGACGTCGCGGTGCAGCACGCCCTGCTCATGCAGGTAGGCGAGTCCGCGCAGCACCTGCGTGATGTACATGGCCACAAGCGTCTCCGAGA
GCGAGCCGAAGCGCTTGACAAACTGCGCCAGCGACCCGTTCTCCATGTATTCGAGCACGATGAACAGGAACGACTGCGTCTTGATCGTGTCGTGGTACTT
GACGATGTTCTCGTGGTTGAGCTTGCGCAGCAGACTGATTTCGCTCTGCATATCATCCATCACATCCACAAAAGTGTCAACCTCCACACCACACACAAAC
ATCCCCACATATACACTGACCTCGATCGACAGCAGCTCGTCCTTGTCGATATCGCGCAGCGACACTTGTTTGATGGCCACAGACCGTCCGTTGCGCAGGT
CAAGCGCCGCGAACACCACTCCAAAGCCTCCGCGACCGATCTCTGAACCGAGTTGCTGCG