Description :
From Genome Similarity Track
Location :
Scaffold_187:1600- 4450
Sequence
2850 bases(100 bases per row)
GAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCCTCGATCCTTAAAGATCCTTTGG
ATCCCTTCTATCCTTTGGTAAAGGAATTTCAAGATGTGTTGTGTCACAACCCACCATCTGTATTACCTCCTGATAGAGGTATACGTCATGAAATTGACCT
AGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAATGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGA
ATGATGCGGGAGAGTAAGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAACAAGCTTAATG
CTACCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCATAACAATATGGTTGGATGTACATTGTACAGTGCGCTCGACTTAGTTGATGG
TTATTACCAGCCGCTCATGCGAGCAAGCGATATTTCGCTAACAGCTGTTACCCCGATCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCA
AATGCCCTGGCTACTTTTAATCTTCTGGTGACGCAACTATTCAGACCCCATCGAGGCTATGCACAAATATACTTTGATGACATGTTTGTCCATAGTCGTG
CAACGAACGGTCGATCCGATGTGGATAATCACATTAATCATTTACTAGCGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTG
CATCTTTGATGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAAGCCTTCGAGCGGACCCCGCCAAGATAAGGGCCATAGTCGATTGGTCG
GTTCCAAAGAACCAAAAAGATTTACGTAAGTGGGTTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATATGGCTCGGCCATTATCCA
ATCTCCCTAAGAAGGATGTGAATTGGTGTTGGGGTGACACCGAACATGAGGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTT
GACCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGGCATAGCCAGTGCTCTGTTACGAACAGATGTCGATGGACGCGAACGCGTC
ATTGCATTCGAATCTAGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGGG
TACATCTGCTTGGCTCAAATCCATTTGTGATCTATACAGATCATTCGTCATTGCGCACTGAGACACAGTCGCCGCATCTCTCTCAGAAGATGGCTTGTTG
ACTTTCATCCTTTGCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGGAAGAAAATACTTTGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCTTG
CTCACGTCACTATGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAAGATGAATAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGA
GGAGTTTTAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCTTGTTGTGCTATCGCACAGATATT
GAGGATAACCCTCGTAACGCTGTCCATCATGATGAGGAGTTGAACTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTG
AGAAGACCTATAGCTCAGTGAGCCAGGCTTATTAGTGGCCCAAACTATAGAAGTGGATGAGCACCCATGTGCGTACGTGTGAAACGTGTCAACGGGTCAA
ACCCTCAGCACATGCGGCGGCGCCGCTGGCTAGTCTGACTGTACCCATTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGAT
TCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCCAGCGGCAGTGTCGGACTCTATCGATGCCGAAGGTACAGCGA
AGCTGTTTAACGACCATGTGTTTCGACAATGGCTTGCCAGTGGTAATTGTCTCTGATAGAGATCCTGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAA
GGTGCTCGGCACCCGTTTGGACACGTCCATAGCGGATCATCCGCAGACCGATGGTCAAATTGAGCGCGTTAATCGCGCCATTAACGACATTTTGCGCAGT
GTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCTGTTGTTGAGTTTGCGTTGAACAACGCTGATCATGCCTGTACAGGCTATACTTCGTTCTA
CGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACTCTACTACTATGTGGTTCAGGGCTTCGTGGGGGAGAGATTGCCGATCGGCTTGCTGATATCAGC
CATGCTACTGTCCAAAAACAGTTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAATCAAGACCAACAAAA
ACAACAAGCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATAAGGTCGGAGACCAAGTATTACTCAATTCTAAAAACCTACCTACAAATGTAGTGTCT
GCTGTCTTTAAGACAAAGTTTCGTCCACGCTTCATTGGACCATTTACAGTTACTGCCAAGAAGGGACTTGCGTATACGCTAAACCTTCCGCGCAAATTGC
GCACACACCCAGTGTTCTACGTAGGCTTACTTAAGCCATACCGAGATCCT