Description :
From Genome Similarity Track
Location :
Scaffold_450:1600- 3840
Sequence
2240 bases(100 bases per row)
aggtcgagacgatgattcggatgaacgctgttggtttggtttttgttgagcttgtttcacgatgccttgatgtccagcgatagagcaaagtttgttgatt
gctctatccaactctcgaatagggtggttggaatcctcacgaatgaccagtctaagactgtcagcatgtttgtaccaggcgttggctatgaacgaactga
gagcggcgttattcgactcacttgactcaagtccattcggtgttgctattgctgccatggctcgaagtcgtaaggaatactcgcggtatgtctcagaatg
cttctttctttcgttggcaactctcaacgcgacttgctggttggatagcttgctgctgaattcatttctcatttcgtcgcgcacattctcgaaagaactc
aatctgaagtctcgcatattggctatgtaccattggctggccgcgcctcgcaagtgctggaatagcagagcgtttttcatgcggtcggggagcaatacac
cgtgcagatcttcttgtatgccgagcaaagcttcaaaacgcatgagccatgctgaaataccggagtccagtgcccctggtggagtcgttccgtcgaactt
ctctaccttgaaggtcttgatcaccctgctgtaccgcttcgcatttgtttccgcctgaggttcatttcctgcgagctctgcgagttcccgagcctgggcc
tcacccgggtgatcgcgttcagcgcgtagagcattggcttcgcccagtggttggcgattgttttccccgtattctcctctttcacgttggtggtcaccct
ccaagtcttgattttgaactaggggtaactgtggatccataatggctcttcgaagtgagatagctcagtacgaagcctgcggctgttaacctgttggaag
aaacaaacggcttgttcttcagatgggaaaagtggaagtgattcatttctcaatcttacggaagaaaatatcagatagagacggaggattctcacctggg
gtcatcaagaggaacaaccaagctcgttactccgacacttccccgtgagcgctggttgcgaggtattcgaccccaatatccttgcgtatttcactgaatc
gagttgctcccaatgctttagtaaatccatccgctcgcatctcagtagttgggcaatagttgagttgtaggagtccacttgtaaccgcttcacgaataga
gaagaatcggcaatcgaccgtcttctgcgcctcagagctcttgccatttgtgagtcgttttatggtcgatttgttatccatcatggcaggaattggagac
ttgctttcagtctttagtagtcgctccagaagcatcttgatccaaattgcctcctccaccccgtcgtcagctgcctggtactcagcaatagtcgatgatt
tgagacgatcctctgtctcttggtttgccacgagacggagcatccaaatacttgcaccaacactccagaaactgattttcgatcttcttcattgtttgcc
cagtcagcatcggtgtataccaggacaggaacggcatcaacatctcgacggtaaacaagtcccatgtgatagatccccgctatgcatctgagtatgtttt
tgaccgctgtccagtgggcctttgaggggtttgacgcttgtgcggctacttggttcacggcgtaggcaatgtcgggtctggtgacccgagcgagatacaa
tagcgctccaactgcctgtcggtagggtacgtcgccagcgctctcttcgtcttgtgttcttcgatacaggattacgcctttgtccattggtgtctttcga
ggtctgcaatcttgccatttgaaaacgacgtaggagctcaatagcaaattgggattgatccagggtagtgacgtggttgatgacgtctagtcgaacacga
actccgagaaaccagtttatctctccaaggtctttgacactgtacttcatccgtaggtcttgcatcagattgtccatttcgcgctcgtcctggtagccga
tgagtatgtcatctacatagatcagaattatcagaatgttagcagggtgaacatatacgcagggatcttcacgagtgggagtaaacccaagttgaaccag
aaacccgtttgatctccaaattccacactcgtccggcctgctttaagccataaagtgccttcttgagccgccaaactttggatcggcttccttcttcaaa
tccacggggctgccgaacatatatctcttcggtcagtcca