Description :
From Genome Similarity Track
Location :
Scaffold_354:160- 3635
Sequence
3475 bases(100 bases per row)
CACCGGACATTATTCCTTCAGCCCTGACGACGATGACGATGACGACGAAAGTCCGGAGGATTCAGAGGAGGCTCGAGTCGCCGATGATGCCTTGGAAGAA
GACACACGGCGGGACCTGTCCCAATCCAGATCCGAAGCCCGGCGGAGATTCCTCTCGACACCGCCCCCGTAAGTCACAGACACGGCCGGATCCGGGGCCG
GCACTGCGGGATCCGCGATCCAGATCGACAGTGACGGTGGGTCGGGTAGCGATGATGGAGGGGGATCACCTCATGGTGGCGGATCCCCTGGATCTGTCCT
GATCCCCGCCCCTTCTAATTCTTCTTTGCCAGGGATGCTCCCCGTGGCCCCGTTTGGTCCGGATGCTGTCTTCATTCCTGCTCGGCGCGCCCCTGTGGCC
TTCGCTACAAGAGACATTGAGCCTTGGTCCGCCAAGAAACTGAACCGGATCGCCACCGTCACTATGAAGATCACTGTCCTGTTCCCTGAGCTGCCATTCC
GTGCTGAGTGGATATTCCCTCGGGCAGAGGATGTCATCCCGACGGCCGGCTATGTGGATTTGCTCGTTACCAGATCTCACGTGGAAGAACTACAGGATGC
CGCACCATGGGATACGTTGACGACCGCACTAGTGGATCCTGTTAGCTTCCGAAGTGACGTCCGCGGGCGTCTCGGATTGTTCGTTCGTGCGTTCCGGGAT
TTCGTTTCCAAGCACCGGGTTGCCATATGGGAGGGCACTCACCGATTCCCCATCTCTCGTAATCAACTGCAGGGTTCGACTTGGTTGTCCAACTTCAACA
AGCAGCGCGGCAACCGACGTAGTCACGCCGGTCGGGCTTGGAAGAGAGTCCTTGTGATCCTCGTGTTGGCGATCCAGGACGGTTGGTGTGACGTGGATAT
TTTGTTGGATCCATCCTTCTTGCACCTTCCTCGACGCTGTGGATAAGGTAACATGGTTTCCGGGATCCGTATCCCGTCAAGCCAACTTCGAGGATCCCAA
CCTCCATCGCCCAGAACCCATGAACCTACTGGAGGCTTTGCAAGAGATCGATGAAGCCGAGCCTTGGCGTATCCAGTTTCGGGGGGACCCGAGCCAACAC
CCAGGACACCAGATCCAGCGTCTATTGGGCAAGTTCTTCAATGTTCAGCCCAAGACCACCTGATCCCTATCGCCCTTTTCCGCTACGCCCCCAGTTTCAG
TCTTCGTGGATCCGCTTCGTAGTGGTAATGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAAATGCAGTTAGGACGTTCCCACAACAATACGTCTAC
TAGGATAGTAAGCGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGAAACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAG
TAAAAATAAAAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGAAGGCCTTTT
ACGAGATACCGAGTGTTCAACACTCGGTTGGAAGAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAAATAGGCAACAATAAGCCGTCACGTAA
AACCTTCCTATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACCGAGCTTCGAGATCACCGACAGGCATAACACACTC
AAACAAGCTTGACCTGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTG
TTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAATATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTG
CATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCTTGTCCCAGACGGTGAACGTGCCTTCCAAGGGTCGCTGAGTCTTCCGC
GAACTCATCCGAACCGCCGCTGAGGGTTCGTGCCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAG
TGACATATGGCCGTATCCAATACTCGTTGAAAGCTCGGGAGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACATGACCAAGGGTTCG
TTGCTTGAACATCTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGAGAAATTACTACACCACAACTGCCCCTGTCGCAATGGAA
GCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGCCGTGTCCGACGCGTT
TCAGCGTCTTAATCCTCGGAGACGTCGCGAACGTGAACAGCTGGAGGTACGTCAGCTCATCCTTCTCTTGAATCATCGGCACCTTGCTCATCACCTCGCA
TTACTCGACTTGTTTCTCAGGAGGGCAAGGCCGAGGGTTCGAACACCCCTCAGTCTGCTACACTTCCTCCGACAGCAGCGTCATCAACCGGCCCTCCGGC
GCCCGGTGCCCCGGACTCTTCGCTCCCTGCGGTAGCTCCTGCAACACTCCCCATCGTCGCTGAATCCGCGGAGATGGCTCCTGCTGCTTCTACTGCGCCT
GCCGGTGGTACACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGCATCAGTCGATCACATGATGACCTCGATAATTCTGT
ACTTGACTGCAATGGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCCCCTCTCCACGGCGATGTACACACTCAGCGTCGCCTCGAGACTGCTGTTGGTTT
CGATGATGTTCTCGCGGCGGTACAACCTATTCCTGACGCGCTGTCGGCATTACCCAAGCGAGTCGCCGACTTGGAGCGTCAGCTGCGGTTTGCTCAGTCC
GAGGCTGCTGCCTGCGCACGTTCGGTGGTACCTGAAATCATGGCTCGTGAGAACGCGGAGGCGTTCCTCAAGGCTGCCAACGCTGAGATTGAAGCCCTTC
ACCACAACGTCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTTGCCACTGTTCAAGCCACTATGGAGCGACACGCAGAAGACTTGAATCG
TCTGCACTGCGAGGTCCAAGCTCGGGACGTGTTTATCAGTACGTTGCAGAAGAAGCTGGCTCGCGAACGCGAGGTGTACAAGTCTTCTATTGGAGCGAAT
ACCGAGCAGACTCGGAAGCTTCATCTCCTTCTGGTAAAGCTTGCCCAGGGCAAGTACGTTGATAACGACACGCTCAAGGTCCTCGAGAACCAGCAAGACC
GTAACACTCGTCTCCTCCAAGCGAATCGTACCCTCCGTGCACACGTGAGTCTGGCAGGGATGGATCCCGAGGTAC