Description :
From Genome Similarity Track
Location :
Scaffold_1402:160- 3154
Sequence
2994 bases(100 bases per row)
CAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCCTAGGGGTAAATGTATCTCTTTAACTATCTAGCATAGTTAAACCTAATCAAATGC
ATAACGTGTGGCTTTCAGCCAACGTACTGAGATACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTG
TGCTCCACACCATGTAACCCCGTTACAGGAAGAACACGTACTGTGGGTTCGTCGAACGAACAAGCTAATCCCGTCAGTGACGAGGTTTCGACGTGGACGG
CCTCAGAGCATTCGATTGACAAACGTGTCTGATCGAACTGTGTACCTGCCAGCACACGACTCGATCGCGATGTGGATTCCAGATGGGAATTTGCCACGAG
GTGACGGCTATGTGCGCCTGGAGTCCAAGAAGTACCAAGACTGGCAAGTGTTGGCCTACGAAGGTTGTAGAGACCGCGAGCTCTTTCAGCGTGAACGCAA
AATCTACGAACAATGGCTTGCCACTCAGCCTTCGGCAGTTGATCGACCAGACTACCCAGAACCCAGTGGAGTGCTAGCACGGCCTCTTGAGGACTCGCTA
ATGGACTCAACTGATCGACGGACCTGTGCAGAGCGCTGGGCAGTGATCATGGAGGAACGTGAACGAATGGAGGCCTGTCTGGCGTCTGGGGTGACAGCGG
GGGACTCGGCCGATGGCTCAGTCTTCCGAAGAACCTTTAGACACTTACACGACAGCTCACGGCGGGGGAAATATTGCAAACGAAACCTCGATAGCGTGTA
CACACGAACTACTGAGGCCGGTAAACGTGGTACATACGCCAACGAGTGTTAGTGTCCAGTCAGGGGTGACCACGGAAGCGACAAGTCACGGCACTGGATT
GAATGGAGTCACCCGTTTTAACGAAGCTGTCCCGGCCTTGTGTGTCGCCAAATCTGCGAACGAGCCACCGGTGGTTGATCCAGAGGATACAGGCATCGCG
CAGAAGGTGTTGAGTACGGCACCGAGTATTCATTGCGAGATCGGTGCGAATGTCGACCTTTCAAGACAATGGCCGACCGAGGCGCTGAACAAAAGTCAAC
AGCCCAATATGTCGGTTGCCTGCGCATTCAATATTGCGAACAACGACTCGGCAGGTGGCCCAGAGATGGGAACCCAGGATGGGAAGGTGATGGACCCAGT
ACCGACTGTTGAAATCGAAACTGATGCCGAAGTTGAGTCAAGAGAAGAGTCCGTAGCGACTTTGGACGAAACGTACATCTCGGTTGCTCGAGTATTTACG
ACCGAAGGAAATGAAGCAACAGAGGATACGAGAAATGACTTCTACGAACACACGGTTAACAACATTGGCTTGGATGACTACGCGAAGGAGCTGGCATTCC
TGCCGGACCTGACCGAAGAGATTAACACGACAATTGACTACACTGCGCCTAATGTTGCTGATCCTGAGCTGTCGACTGAACGCCGAGAACGTCTAGTCGA
GACGCTAAAGAACCACGAGCACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTACGGGGCGATATGCGATATCGACACACAGGGGCACGCC
CCAATTAAACAGCGTGCCCGGCGCGTGCCGCTGCGATTTCTCGGCAAGCTGTTCGAGCTGCTGCGCGCTTTATTGCGTACAGGACTGATCGTCTTTTCAG
CCAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGAT
CATGGAGTATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTC
ATGATGCCTTGCGAGCACGTAAAGTATCGGGCGTTTGTCTGCGCACTCAGACAGTTCGAGTGGGTTGCGCATGCCCTTTGGATTAAAGAACGCGCCGATG
ATCTACCAGCGTATGATTGACAACGCACTCTGGGGGCTCATTCAACCTAAAGGAGGTGGTTTGAATACTCGGAGAAGATGCGTTTAGCTGAAGAACAGGC
CAAGGAACGTCGTGGGCCAAGCGCCGAGGGTTCGTCTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTC
AACAGCCCCGTCGCTGACATGTTTACGAACGGGGAACCAGACGAATCATCGCTGGTACCTGTATTTGGCCGACGGTCGTTTGTGGATGATATTTGCTTCG
GTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTGGCGAGGTTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTG
CCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGCATCAGGGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACG
AGCAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGG
ATGAAGACTTTGCCGTTGAAGGTGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCGTCAGGCACTTCGA
TCGGTCGAAAGAAGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACAACCCGTACGGTTC
CTCAGTCGGGTGCTCAAGGAGGCCGAGATGAATTATCATCCTGCGGGGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTAAGTCCAGCTGG
CAGGAAAGACGCTACATGTCTATACACGATTCTCGACGTTAGGGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGT