Description :
From Genome Similarity Track
Location :
Scaffold_2954:160- 2636
Sequence
2476 bases(100 bases per row)
CCTCAGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGG
AGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGCTCGGATCCGACTTGAGGCGGCGGCGGTGTCTTTGCCGACGGCGTCTG
TGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGATACTGTTGTACCCACACATGAAGCGT
GTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGT
CTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGCTACCCGCCTGT
GGACTTAAGTTACCCACTTGTCCGACGCCTCTTCTACGTGCGGCCACCTACAAAACATCCTGGGAGTCGTCGTATACGTCGACGACTCCCAAGCATCTGC
CGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGATAGAGGTGGGAACATGACTCACCAATGCTATGTCGGACTGCGCAGGGCGGCT
GGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTG
AGCTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCG
TCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGCGTCAAT
CAAGATTCTAAAGGGATGATCGTTTCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGG
GCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTATAGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTG
TCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCC
CATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGCTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGTGCCGACAAG
GAGCTCCCAGGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGACTGC
ACCCGGAACAGCTGAGTGTGTGCGGGGCCTACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTTAAATGGTTTTCCCACTAGGGACGCCG
TGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGTAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAG
GAACGCGGCTCGGAGCTGTTGGCACAGCTGAGACCAGGATGAGAAACATCCAGGGGATGTTGCTTCCCGTGTGTACACCCAACTCTTAGCACGGCCGCTA
AGGTTGGAGAGTGCAAAAGCAGCACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGC
CTTCTTTCCCTTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTTCTTCCGCCACCGGAGCCTGCAGGTTCTCCCGCACATGCGC
GATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATTCCGAAGATG
CCTGCCATCTTCTGAACCGACTCGAACTGAGAGCCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAGCTTCGGAGAGGTTCAGGTAGTCTACC
CGCGGTGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTCCCGAGAGTATACAAACTCTCA
GTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAGAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTT
GGGTTTAATACAAACTATATGTTACCTATAGAAATGCAATGTCGTTTGACCAATGGTTGGCTTTGAACGACCTTGG