Description :
From Genome Similarity Track
Location :
Scaffold_287:16- 7444
Sequence
7428 bases(100 bases per row)
GGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCTAGCCTTACCGCGTGTT
CTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACATTCTTTCACCCGATCCAAATAAAGCCACACCTGCGAT
CCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTCTGTTGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCC
GGTAGTATTTCTGGACTTGGTATCGCCATCGCCTCGGATCTCGGTTTTTTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGAT
CCCACCCATGTACCAAGTAAAATGGGGTATTACCCCGGATCCTGTCTTGGGCGGTGTTTATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCT
CTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCT
CGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCGTGTCTAATCGTCTCGCTAGCTCCAAATCTTC
GGAAAACGCACTCCTCGTACGATTCGGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAA
CAATTCTGTGTTTCCTCTGAACGACCTTGGGCAACGCAGGGGATACGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACT
CCCCTTCGACTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCTCCTCCAGTGAAAACATTC
CCGGATCCGTTGGTAGATCCGACCAATACCCTGGTGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACC
AGTCTCATCAATCCATCCCGACCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGC
TGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATC
CGCTCGATACGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGCCTGGATCTAATCCTCCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCC
TTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACATAACGAGATCCTGATGCTCGGCTTCTCTCTCCACTTCAACACCACATTGATTCCG
TAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTC
TGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTATGATCACCAAATTTGAATCCCCACAAATCACCAGTCTTTTCGGAT
CTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTAGTACTTC
CCATCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGACCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCC
TGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGAGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCG
CGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTG
TAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGC
AGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGGGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCACATGTT
CTTGTACCATAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTGGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGAT
CCTGTTCCTCAGTTCCGCGAATGCGTGCTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCT
CTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAG
CTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCGGCGAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGAT
GAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTC
GCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAAAGATTCCACTTAGTAC
ACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTCGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGG
GGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCA
TAGAGGGCGTTATCGATCAGGCTTTGGTAGATCTGGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAAT
GCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACA
GCTCATTGATTAGAGGCGTCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGAT
GATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGA
GGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGATAACGCATTACCTTTAC
CAATCAGCAGATGTCGGCTCTCTTAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGAC
CTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAAATCCCCGCCTTCATGGTAACAAACTTGCTCATCT
TCCGTCTTCGTAGGATCCATCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGA
AACCAACAGTTGGATATAGTCGGTCCTCTAACGAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATC
CAATGGAAAGCTTGGATCCACTCGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGC
CGACTCTGGGGATCGTTCCCCGTCCTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAG
GCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGAGAGCTCCACTTCTCCGAGCGATTCGATCTCGGTAGCCGCCTCGTACACCAGATTCTGCCATTCTTT
GTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCGCCTCATAATGGTCCAGTAATAGTCTC
TTATCGCTGACGTTCGTGACCAGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCAT
GTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAA
CGGGCCGCCGTCGGGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATTCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCA
TCCCGAGGATGGCGTCTTGGCCAGCGAGATCTCCAACCCAGATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATT
CGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATTCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGAC
ACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCC
AGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGAC
CTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAAACTTCGGAT
CTGGCAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCGCATGTATTATCGACTGGATCTAGGGTCCTGCTACCTG
GATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTC
TCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATTGGGCACTTGCCGACGTCGTGAA
TCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCCGT
GTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTC
GGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTG
ATTCAGCTCCTGAGTCGAGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGC
CTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCC
ACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGGCCCGTAGACCGGCCACATTT
AGTCGATGTAGGTATTCTAGCGGGGATTCATCCCGATCTGCGGCGAGCGTGGTAGGATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGA
AAACTGCGCAGCAAATCTGGTCACTTGTTCCTGGCGGATCTGCCCAGCTGTCGATACCAGTTCCTGGCTGGTCCAGCTAGCAGATCCGCAAAGGTCAAAC
ACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCTGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGGTCCTTACCCGTGAACTC
CTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACAACTGCTGACGAAGTGAATGGG
CCATCCAGATCATCTGGGTCGAGCTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTT
GTGGCCCGGGTGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGT
GGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGTCGGATCTGGCTCGATCG
TGGCTGGATTGTGTCAGATCACGCGTGGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCAGCTCCTCGCCCGCGCTTCCAGCA
TGGATGCCCCGAAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTTGTAGTTCGAGGATGCAGCTTGGCT
GACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATGC
AGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCG
CCGTTTTCGTTGGTGCTCTCACCGGCTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGC
TTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTA
GTCTTACTCGTTTTCGTCTTCTTTCTCG