Description :
From Genome Similarity Track
Location :
Scaffold_1795:16- 3757
Sequence
3741 bases(100 bases per row)
CTCCCCGTCACAGAAGCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGG
GCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAAACCG
TTGCCAGAGATTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATGA
GACCTGAGACCACTCAGGAGGAGCTGAATTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGA
GATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGC
GTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCG
CCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAATGTGGCGTCTGGTTCA
CGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGT
GCGCTGGATTTGGTTCCAAAAGCAGCCTCACTAGGAGATAACGACGTAGCCGTGTGATATTGTGCTTCAAAAGGCCCAATACTATCCTCTGCCCACGGTC
GAACTTCCATCGTTTTATTAGACAACTTTCCATAGTTTGATCTTGTAGTCTTTGTTTTTGCACATTCCTCACAATTGTGCACCCAATTATTCAGGTCGGC
ATTCATTCCGAGCCACGTTAGTTACACCCTGACTAATTCCAACATGCATTCGCCTGGATGCATCAACCAAAGGTGATAAGCGCTTAGTACTTTGCCTACC
AATGGGCCTGGTAAAGTGATTTTCCCATTTACTCTGCTGACAAGTACCGTCGTATTGCCAATCACACATCTTACAGCTGCAGGTCCTTCGTGAAGGCCCA
CTAGCCGTTGCGTTTCTGCGATTTCTTCGAGCGAGAGTGAGAATAGTGCAGTGGATTTGTTGGGCGCAGTAACGGCCGCCGCTTCTGCTGTATTGGGAGC
TGTCTGAATTGGGAGTCGCGACCCCGATTGTAACGGGGTACGTAGCACCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATAC
TCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACA
AACTTAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTA
TACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCT
GAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGG
AGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGA
GAACCTGCAGGCTCCGGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCAC
TTCTGGGTCCGAGAAGTAGAGCTTGCGATGGGTAGAGCTTGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAAC
CTTAGCGGTCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGT
TCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCT
CACGGCGTCCCTAGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTAGTTCCG
GGTGCAGGCAAACACCCTTGAAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN