Description :
From Genome Similarity Track
Location :
Scaffold_350:16- 2530
Transcript NameFunction/comments
Hyaar_Emoy2813846hypothetical protein

Sequence
2514 bases(100 bases per row)
TTGTCTTCATTTCCATTCGATCGCTCCCATAAATCGTCTTTCTTCCTTTTTTAGTGTCTATTCGTCGTGATCGCACCATTTGGTCTGCGATCACCGCACT
CAATTCACGCAAATTTCATTCCATCTTCATGTACGACACCCTTACACCCATTACTCCCATCCCCTTCCATGAACCTTCCCTGCATATACCCATCCACTCA
AGTTCTTCGATCATCGCTAGTCTCTGGCTTCTTCTTCGTTTGATTGCATCAATTCAAAACAATTCCTGCTCACCTGATCGCTATCAAACTCCTTCAACAT
AGCTCCACAATTGAGATCAGCTTCATCAATCCAGGTTGGGTCGCTGTACTACTTCCATTAAACCAGGGTCTGCTTGTGTATTCGGCCATATATCGTGTTC
CGTTCCAATCGCGCATCAAAAATCTTATCCACTTCGAACTCGTCTGCATCGAGATTACCATCCCAACTATCTTCAGGCAGCAGGGCTTCGTCCAAATCGA
GACGACTTGCCTCATCCATGTTCAACTTACTTGTAGGGCGTTCTGGGAACACGCAAACTAGCTTCAACTTAGAAATGTGAATTATTGGGAATAGCCGGTA
CGGCGTACCCGCGATTTCCAACTTTACAGCGTGATCGCCTCACTTTTCGGGCACCCGAAAAGGTCCATGCTACATATGGGCTAGCTACCGAGCATATCCT
TCCTCAGTTCGGTCCAGGTATAGTCAAAATCGTGACCCGCGATCGATATCCAATACATCTCGATCTTTAATATGTTAATCGCTCGAACCTTGATGGCAAC
CTCCAATCGGTCATTCACTACCGCCCGTGCACGCTGATATTGGTGTTGTATGCCATATCTCCACCTTCGTGCGTCTCAATCTTGAGGTTTAGTGCTTCCC
AACGGTAATGTGGCTTCTAAGGTTGATCTTGGGTCCCAACCGTGAATTAGGTAAAACGGTGTGTCTACACGAATTCGATCATAAGCGATGTTGATCGCAT
AAGTCAATCGCTCTGCGTATTCGTCACAGTCCTTTAATATTCATCCATGACATACATCTTGATGGATCGAGTCAGTGTCTGCACCATGCGTTCGGCTGTA
CCATTCGCTTGCGGCCTATATGCCGTGGTGGATTGCTGTTTTGTACCACGATTCGATTAAATTCTCAGAAGAAATTGGACAGGCTTGCGATCATGACGTA
TCGCCTCGCTCGCAACGAATCGTCTGAACACGCATTCCTCGAATTTTTCACGATCTTCTGTGCAGATCTGGACGAGCTTGCCTTTCGCAATCACATACCC
CGAAAATAGATTACCCAACAATAGCAGCTCGGTGTTTCCTTCAAAAGATCCTGGCAACGAAGGTATGTGATCCATAGTTATAATCTGAAAGGGGTTCGTC
GATTGCAACTTACCAGGTGGTCCGCTCCGATCACCTGGTCGTCTCTTTTTCTGTTTCAAAATTCACACACTCTACCACATACCGCTACACACTTCTGCAC
AACTCACGCCAATGCAAGTTCGCCCTGATCCGTTGATAAGCGCAACCGATTCCTTGATGAACACCCTACAAACTTGTGTGGTAGTGATGCAAGAAATCTA
GCTGTAACTGCTATGGAACAACCAGACGAGCCACTTCAGTACGGTCCATCGATTTGATGGCAGATCAAGGACGGAAAATAGCAATCCACTTTGGTCTACT
TCATAATCCCGTGCGATCAGGGCGAAAACTTTGGCTTCAGTCGACGACAATCTAGCCTCATCTCCAACCAGATATATCTTCAGACTGGATATCCGTTTTT
CTTCGTCTTGTGCTTGCTTAATGTGATCGATCTGTATCCGCCGCACAACTTCTTCCTGTAAAATCCTGGGCTGAAATTGTCCTCTTAGAGCTGATCGAGT
GATATCCGCCATTTTTACTGCATGATCGACTCGCTCTGGTAACAGTCATTATCCTAAACGATTGAGAGTGATCAGGTCTTGACGATCCTGATCCGAAATG
ACAACTTTTCCTTTCTCTTGCCTTAGAGCTTCACTCGCCAGCCGATCTGCACTCTGATTCTACTCCCGCTCCATATGCAGGATTTCATGGGCTAGCCACG
ATCAGAGTATCCCCATCTTTCTCTGTCTCATCAATAGCAGTCTTGGTGCCTTACAATCGATTTCTCCTCGTAGTTTGGCGGATAACTAAATTTAAATCTC
CGCAGAAAATCACTCGTACCCTGGCCTGACCGGCAAGCAAATCGAAGTTGATAAGTAATCCTCGGTATTCTGCTTCATTCACGGTCAGATCAGGGGTAAA
CTCGGAAGCAGCCGCTAAAAATGTCCACTCCGGCAATTTTCATATAATTGCGCTGTATGCTCCGCCCTTTCTCTTCACTCTAGCCGATCCATCGAAATTG
GCCACTAGCAAGTTTTCATTTTTTCCTAGTAAAGGTGGTGGCATTCTTATCGTCTGTCTTGTTTGCTTCCGCGGTGCAATCGCAATCAGTACCTCATCCA
CTTTTGATCAAGGT