Description :
From Genome Similarity Track
Location :
Scaffold_345:16- 1845
Transcript NameFunction/comments
Physo_125689Polyprotein, putative
Physo_125693polyprotein

Sequence
1829 bases(100 bases per row)
AATCCTTCTGGTTGCTCCATAAAAAGAACTTCATTAAGCTGCCCATTCAGGAAAGCAGTCGTTACATCCATTTGTTCAACTTCATAATCCATCATAGCAG
CGTAAGCCAGCAGGAACCGCAGAGATTCAAAGCGAACCACAGGTGCAAACACTTCCAAATAATCGACTCCATACTCTTGCAAATAGCCCTTTATTACTAG
CCGAGCCTTGTACCGCTCGATGGAGCCGTCTCCTCGATACTTCACTCTCAGCACCCACACCTTCATGCCTGGAGTACGTGGGACTAACTCCCAAGTCTGG
TTCTCCAGCAGTGAATTGTACTCTGTACCTGCTGCCTTCTTCCACTGCATGAACTCTTCAGTCTCCATGGCATCTGCCAATGTAGCAGGCTCTTCAACCA
CTTTTGCGGACATCACGATGGCTTCTGAGTGCCACTTCTGCATAACACTCTTCACAAAGTCTTTCCGTGCTTCCTCTTCGCACGACTCAATCTCTTTAGC
CATCAGGACGAAGTCGCTCATCCACTTCGGAGGCTTGCTTCGACGTCCGCTTCTGGTGGTTGTCGAACGCGGCTCAATTCGAGTCATAATGCAGTCACTT
GAACTCTCATTGCCACTGTTCTTCACTTCCACTAATCCTCGCTTTCGACTGTTGACCGTGCCTTCAATACTACTCGCCTCTGGACGAGCCGCTGCCTTTT
CGTTTTCCTCCAGGTTACTTTGGCCAGTTGCCCGCTCTTCATGCACTTTGTGCTGTACTGCACGATCCACTTGGTGTACTGCATGATCGGCATGCTGCGC
TCTGACAGCACTTGTCGTTCTTGCACGCTTTGCTGGCGGTGCTCTGCTGTCGACGCTCTGCTCTGCAGTACTTTCAATAGCCCCACCTCTTGCTAAACCC
ACACTTGCTCCCTGCCGATGCTTCTCTTGCCTTGGATCGACCCAGTTTCTGCTATCCACGCTGATCGGACGTGGGGTCTCAAAGCTGTCTCGGCCTACTT
CGCCGCCATTCCGAATATGCTGGCTAGCATCTGTCATGGTGTCGGTTTGAGGTTCGACACCTTGATGCATGCTGCACCGTGTTGCATCTTCTGCAACGGT
GCCTCTGATTTCACTGGACTGACCACCAGGAACATTTCTCGCAGCCGTTGATTCATCACTATTCTCCATAGGCAGCACGTAATTGTAGATGTGGGCGATA
GCGTCATGGTCATCAATACTTTCACCGAGAGAATCTCCTGCACTTCGCTGCTCCTGCAGCTCCTTCTTTCGCTGTCGAGCGAGAGCTCGATTCTTCTTTG
CTTGCTCAATCGTCGGTAGCACCGGAAAATGACTTTCGTCAAAGACAACAGTGTGGCTGTAGACAGGTTTCAGGGTCTCACAGTCGAGTAGCTTGTACCC
TCTGCGATCTCTCGGATAACCCACAAACACCATCTTTCTCGCACGTCGCTCTAACTTCTTGCGCTTATCGGCCTCAAGGAAGACATACGCCAAACACTCA
AATACTCTTAGATGCTTCAGCGGTGGACTGTAGCCAAACCACCTCTGATAAGGTGAATCCGAATCATTGGCTCTTGCTGGCAGTAAGTTCACACAGTATG
CACTGGTTACTGCTGCCTCTGCCCACAACTCCTCTGGCAAATTGCCCTCGAAAAGCACGCATCTCACTCGCTCAGCGATCGTCCTTATCATTCTCTCTGC
AATACCGTTGTGCTCAGGGGTCTTCTTCACTGTCAACGTGCATTCCATCCCGAGCTCTTTCTCGCAGATGTTTTTCATCTTCTCATACTCCTTCGCTCCA
TCCATATTGAGGCACTTCATCTTCACTTC