Description :
From Genome Similarity Track
Location :
Scaffold_1843:16- 1565
Sequence
1549 bases(100 bases per row)
CAAGCGCAAGACGAAAAGAAGTGGATCCACGACCTGAAGCTCTACCTACGCGGGGACCTGAGTCAGCTCACTAGCCAGGAGGCAGAAGACTGCGGCGAGG
TCGCAGAGCAGTACGAGGAAGGTGACGACGGATTGCTGTACTTCGTGGGGCGATCCCATCGCAAACACGCTGAGGGGCGCGAGATCCAGCTACGTCTGGT
CGCACCGACCACGATCCACAACGAGATCCTGCATCATTACCACGCGAGTCTGACTGGTGGACACCTAGGGATCTCCCGCACCTACGAGAAGGTCAAGCAA
CACTTCCACTGGCGCGGGATCCACAAGTCCGTCCAGCAGTACGTCGGATCATGCATTGACTGCGAGACAGGCAAGGGCCAGCCGAGGATCCGCGGTGGAT
CCCCAGGAAACATCGTGGCCAAGCGGCCGTTCCAAGTTCTCGGCATGGATCACATCCCGTCGCTGCCAGAATCGCACCGCGGCAACACTGAGCTACTCCT
ATGGATCGACCAGCACTCAGGTTACGTGATCGCGTCGGCCAACCCGAACCGTGAAGCCCAGACCGTCGCCGAATCGTACGAACGCTGTGTGTTCCGTCGT
TTTGGTGCTAGTGAGGTGATCCGGCATGATCGTGAGCCAAGCTTCATGTCTGAGGTATTCAAGGCATTCAACCGGCTGATCGGGCAACAGAGTCGAGCGA
CTCTAGCCTATCGACCTCAAGCCAACGGTATAACCGAGCGCATGGTGGGTACGATCACCCGAGCCATCAAGATGTACGTCCAGGACAAGGATCAGAAGGA
CTGGGACGAGTATGCCGAGCGACTAGTGTTTGCACTGAACACCGCGTATGACCGGACGAGGGAAGAGACACCACACTACCTTGTGCACGGCTGGGACCCC
CGGACCACGCTCGAGGTGGCCACGCCAAAGGCGGATCCAGGGATCTCGGCCACCAACCCGAAGGTCTGGCGCAACATGGTGCAACGCGACTATACGTACG
CTCGTGCAGCCGCCAACCATCTGCTGGAAGCGGCGATGCAGGATCGGGCCGATGTGGCCAACGGGATCGCGACCGGAGGTGACGAGATCGTGGTTGGATC
CCAAGTGTGGTTGTTCTTCAACCGCACCAAGCCTGGTTACGCACGGAAGCTTGCCCACCTGTGGCACGGACCGTTCAGGGTGGCGGATCGTCTCGGACAC
TACCTGCTACGACTCGAGATCCAAGGCTCTGAATACCAGTTCTTCCCAGTTGTCCATATAAACCGAGTGAAGGCACGACGCACCTACCCGGAGCGTCCCG
ACACCGAGCTCGTGACGGAAGGTGAGCGTTTCGACTTCGACGAGGCTCTCCTGCCTGAGGACAGTTGGGATCCACAAGAGGAGACCGGCGAATATGAGGT
GGAAGCGGTCTTGGATCAACGGTATGAGAAGCGGACTCGGCACGGACGCAGGATCCGCGAGTATCTGGTCCGGTGGAAGGGTAACTACCCGCTGGACTGG
ATCGCTGAGGACAGTCTCAACTGCGGCGGGCTGGTCTACGAGTTCGAGC