Description :
From Genome Similarity Track
Location :
Scaffold_1191:16- 1529
Sequence
1513 bases(100 bases per row)
GCTGCGGAACCTGACCATCCAAAAGAACCCGGCGCTCAACGCGTCGTCGCTCAACACGACGCAGTTTGCGTTCCTCGCGCAGCTCACGACGTTCTCGATC
GAGGGCGTGACGCCCACGCGCGCGTGTCCGCCGATCGAGGTCATTCGCCGGCTCAACGGCTCGTTCACCTTCTGCATTGGCCAGAACGACTCGAGCAGCT
CGGGCAGCGGCGGCGTCAGCGTCGCGGACGTCGTGCCCGTGCCGTCCCCCACCACGAACGTCGCCAACGCCGCGCCCACGCACCATCGATCCAAGACGGG
CCTCATCGTGGGCATTGTCGTCGGCGCCATCGCGCTGCTGCTTATCATCGCGCTGCTCTACCGCTGGTGCGTGCGTCGCCGCGACCGGCGCCGCGACGAG
GAGCCGCACAAGCCCACGTTCACGTCTGTGGGGTCCTTTATCGGCGGCGGCGGCAACATGGGCATCGGCAAGCNNNNNNNNNNNNNNNNNNAGCACGCCG
CGCACTCGATGATGGACGACTTTTTGGGCGACCAGAACAATGGCCACTACGACGCGTTCGTGCCGCTGCGGTCGAACGCCTCGAGCGAGCAGTCGTCCGA
CTCGTACCCGATCCTGGGCAACATTGCCAGCGACGGCCCCGACGGACTCGCCAAGCTCGAGTACGAGGACCTCTACTTCATTAAGCTGCTGCGCGTGAGC
TCGCGGTCGGAGCTCTGGCTCGGCGAGTACTTTGGCGAGGACGTTGTGGTCAAGAAGATCAAGACGGGCACGGTCTCGCGCGCCGTCATGCGCGACTTTG
TCGAAGAGGTCAAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCCGCGCTGTCGCATCCGCGCATTGTCGACTTCCGCG
GCGCGCTCTGGGACAAGCACGGCGCCGAGCTCTGCGCCGTGGTCGAGCACATGGAGCAAGGCGCGCTGCGGTCCGTGACCAACTCGACCACGGCGAGCAG
CACGCTGACCGTGCCCAAGCAGTACGCCATCGCGCGCCAGGTCGCCGAGGCGCTCGCGTACCTCCACGATCAGCAGATCGTCCACGGCCGCCTTAATGCG
TTCAACATTCTACTCGACCACGAGTTCTCGGCCAAGCTCAGCGTGTTTGCCGTGTTCCACTACGTGCGCCTCTCGCCGCTCGACTACGAGTGCGCCGTGT
TTGTCGCGCCCGAGGTGCAGCGCGGCCAGCAGCCGACCGAGAAGGCCGACGTCTATGCGTTCGGCGTCGTGCTCGTGGAACTCGCGGCTGGCGAGAGCCC
CGAGACGAACCGCCGGCGTCGTCTGTCGCTGCAGGACTCATCGCCCGAGGCCAACTCGCCGTTGGCGCGGCGCACGGGCTTTACGCTCGGCGCGCAGTGC
TCGTCCATGATGAAGGATCTGATCACAGCGTGTCTCGAGCGTGACCCGGCGCGGCGTCCGTCCATGGCGCAGATCGCCATGGCGCTGCAAACGGGCGAGG
TCGTGGTGTGAGC