Description :
From Genome Similarity Track
Location :
Scaffold_1901:16- 1467
Sequence
1451 bases(100 bases per row)
AGACATGCATGGACAGCGCATCCATGCAATGAAATTGATCTTCCGGTAACTGACCATTATCATCCATGACAGGGTCCCATCGTCTGCCAGCCTTTATTGT
GGGTGCATCGTTCTGCAGATCGGTATTGGCAAGGAGGAACATCTCTGCCAATGTCTTCGGCTTTCCACTGGCAGAGTTATCACTTCCTGAAACCTGCGAG
TCGTTGTGTTCGGCCAACTTACGAGCAAGAAGCCACGGAGCTGAGCCACAATCAGGTCCCAGAGTATCCCAGGACTTGTCAATCAGAAGAGTGATGTCCA
TTTTGTTGCGGACCTGGTCAAAGCAAATTGTCGGCAAGTTTACTTCCACGGGGTAAGGCAAAAAGATTTCTGAAAACAACGACAGCGAATGAATAATTCG
TCTCACCACTCAGCATGAGCATTGCACGCACTTACCCAGATCACGATGCGTGGCGGCGTTGATAGTCAGTAACTCAGCTTGCAATTCGATCTCAACATCA
GTAGTTGCATGCACTTCGTTCTTGAATTGAATGGAGACGATCAGTCGATCCCCTGCCTGCAGCAGTACATCGGGTGATAGCGGCGTGCTGTCCTTCATCA
CAGCAGGAGATCTTTGACAAACAGTTCGCTCATCTTTGCGATCCTCAAATATCTCGTAGGACGCCGTAGCTGTTTTCAGAAAACTTGATACTTTTTGTGC
TGTAGGTTTGGAAGTACGAACCTTCTTTGACGCTCCTGTGGTGACTTCCTCAATGATCGGTGCCTGCTTTTTGCGAATATAGTGCTTTGGCGGAGGTAGT
GCCCCTTGGTATGCCAACTGCTGCATTTCGTAGCGATCATCGAGCTTGATTTTGTACTGCATCCATCGAAAAACGTCATGCTGGTTGCTCGGTAAGCGTT
CAAAGCCAAAGAAATCAAAGACTTACCTTTTGATCGATGTATTCGATCGCCAGCTCGCAGACAAGGCGGTAAAACGCTCCTGTTTTGTCAGCCTTGCAGT
CTTCTACGACTTTCGTGTTCACAGCCACGTCAAAAGCCACCGAAGTTGCTCCCATCTTGTCCTTCACCTCATGCGGCGCACCCAGACTTAATGGCACATG
AATGCCCTACACAAACACAGCAGCTTGTATCTATCAGCCCGTAGATACTCGTTATAGTACAGTGACAAAGCCGTTACCTCGTGTTCCTTGCCTTCGTCAT
CCAGCTTTCTCTTCACCGAAAACTCTTGAATCTCGTCGGCAAAGACTACGTTCACAAACACCTAGTAACGTGCATGTCATCACCTTCGAATCGGACGGTC
CAATATCCATGCAAGTATTGCACAATGTATTCAAAGAAACAAAACAATCGTCGATAGATACCTCCCCCTTGTTCTTCACGTCCCTTGTCTTGATCGCGAA
ACCAGCTTTCACATCAACGTATACCTGTCCACAACATACAAACTAGCTCAG