Description :
From Genome Similarity Track
Location :
Scaffold_838:16- 1330
Transcript NameFunction/comments
Phyra_86568Hypothetical protein

Sequence
1314 bases(100 bases per row)
AACCCCACCACGCGACTCACACACGCCCACACACACCTATCTACACTACACCGCACCTGCCACCGTATAGCACGCCCGATCACTGCTCACCCGCGGCCCG
ACGACGTCTGGAAACCCGAGCTCGCCTCCACGCTCTTCGCGGCCACGTGTGGGAACTGCGAGGCGCCACCCAGCTCGCACAGCGCCAGCACAGCACAGCA
GCACAGCAGCACAGCAGCGCGGCAGTAGCTGACTGTCCGGTCGCCGTGCTGGCCAGCATAAAGCGCGTCCATCCGGTGCGTGGCGGCGGCAGGAGCGGAA
AAGCAAAATTCCCAAACCGGGACTCGAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTAACCGCCTAGACTATTTGGGAGCACCTTCTCTTAACCAAA
CACCACGCCCACACACAACCCCACCACGCGACTCACACACGCCCACACACACCTATCTACACTACACCGCACCTGCCACCGTATAGCACGCCCGATCACT
GCTCACCCGCGGCCCGACGACGTCTGGAAACCCGAGCTCGCCTCCACGCTCTTCGCGGCCACGTGTGGGAACTGCGAGGCGCCACCCAGCTCGCACAGCG
CCAGCACAGCACAGCAGCACAGCAGCGCAGCGCGGCAGTAGCTGACTGTCCGGTCGCCGTGCTGGCCAGCATAAAGCGCGTCCATCCGGTGCGTGGCGGC
GGCAGGAGCGGAAAAGCAAAATTCCCAAACCGGGACTCGAACCCGGGTCGCGTGGGTGAAAGCCACGTATCCTAACCGCCTAGACTATTTGGGAGCACCT
TCTCTTAACCAAACACCACGCCCACACACAACCCCACCACGCGACTCACACACGCCCACACACACCTATCTACACTACACCGCACCTGCCACCGTATAGC
ACGCCCGATCACTGCTCACCCGCGGCCCGACGACGTCTGGAAACCCGAGCTCGCCTCCACGCTCTTCGCGGCCACGTGTGGGAACTGCGAGGCGCCACCC
AGCTCGCACAGCGCCAGCACAGCACAGCAGCACAGCAGCACAGCAGCACAGCAGCGCGGCAGTAGCTGACTGTCCGGTCGCCGTGCTGGCCAGCATAAAG
CGCGTCCATCCGGTGCGTGGCGGCGGCAGGAGCGGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN