Description :
From Genome Similarity Track
Location :
Scaffold_884:16- 1286
Sequence
1270 bases(100 bases per row)
TGGACTGCCAACACTCCCGTGGAGTTGGTAATGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTA
CTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGA
TAATCGTACATGATCCTGAGTCGCAGGTCCTGGTCAGTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCA
CCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGC
GTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTAATGACGTCGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCG
TAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATTTCG
GCATCCGTTGCGAGATGTGCGGCGCCTTCACAGCCGTCCCCAGCGACACGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGCGTAGATACACTCGGAA
CTTCGCGAGTGCGTACTTCATGGCAAGGCGTTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGGCGCGATTGGTAGTAGACGACACGA
TCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGGCGGATGCGTCACACACAACGTGAAACGGGCGATCTTGGTCGGCCACCGCCA
AGATAGGCGCCTCAGGCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAG
CGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGAAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCAC
TCATTGATCACTCTGACCTTCTCAGGGCCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACAGGTATCTCACTCGCCCCGAAGATACACTTCT
TCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACAAGGTGCATCTC