Description :
From Genome Similarity Track
Location :
Scaffold_2565:16- 1178
Transcript NameFunction/comments
Phymu_g14193hypothetical protein PHYSODRAFT_246736

Sequence
1162 bases(100 bases per row)
TCGCCGTCATGTTCCAACTACCTCGATCAAAATTCCACTGAGGGCTCAAAGACTAGTTCGCGTTGGCATGGTGAGCACCTCCCCGACGAAACGAATGGGA
TGAAAGGCCAGCAGAAACGCCAGCTTTTTCCTGACGTGAACCTGCAACCTTGAGCACTCGATTAACATACGCCTGCATCTTGAGCGGAGCCGCTGAACGG
CGCTGCGATGCTGGCCCTGACGTTGACGAGGCTGAAGGGGTGTCATCGCCGCATTGTAGTAGTGCTTCCGTCAACGGAATggtctccaccacagctgAAT
CGTCGGGTGATTTATCATTtgcaagatgctggaggtCGAGAACCGATGTAACTGGGCACGTTTGCATCGCCAGCGCCATGTCGATAGCATGGAGGGGACA
CGTAATGAAGGACGTTTTGTCGGGAAATAGAGAGAGGCCTTATTCTTCAGATGTCTTTGCGCGAATTAGACGGAGAAACAGGACGTTTCCAGAAGAAACG
GACAGGCTGCACTTCTGAATAAATGCCAGGTCACACGATCACCCAAATGCATACCACACGATGTAAAGGAGAGCCGCGTCTTGGTACTCCTTGGACGACG
TAGCGTCGAAGTATAGACCATTGACTAAGGAGCGTAGATCCGCCTTGGTGCACGCAGGTGCCTTGATCACTGCCCCTCCCTGCTGTCGCTTCATGCAGTG
CCGCTCCAGGACCCTCCCCATCTTCAGTAGACGCTGCTCAATGGCGTTGCGGTGCTGAGGATATTTTTCCAGTAGccagttcttgacgttgcgATAGTAG
CTCATGACGGTGTTTTTTTTGCGGACCTCACCACCTCGACCTCGAGAGAAGGCGAGATACATCGCAAACCGGTCCATCAGCTTGACAAATGCGGAGCCAA
CCTCATCACCCTGAAGCGTAGAATACACGAATTCGATCGTGGTGTTTTTAGATGGGAGGAAGCCTTTGAAAGTGCTGATCGCAGTCGTCTGCGCACGCTT
AGTGTTCCCCGGAGCAAGGTCTTGGAGGCTCATGTTTTTCAAGTGAGATGTCTACTGGTGATTGGATGTCTGCCAAATATTTTAAAGTCTTAACATTTGT
ATTGAGCAAAAAATGTCTGGTTGTCGTTGCCGACAAAATGCGTCGGCCAAGTGTCGGCAGAC