Description :
From Genome Similarity Track
Location :
Scaffold_3968:16- 1130
Transcript NameFunction/comments
Phypl_g16120hypothetical protein

Sequence
1114 bases(100 bases per row)
CATCCCCACTGATGACGACCTTCGCGCTCGTCTTGTTCACGAGTACCACGACGCCCCGTCTGGTGGTCATCTCGGTCGCGAGAAGACGtttgcagctctt
cctcgcgacttcttctggcCCCGCATGTACAAATGGGTACGCAAGTGGGTGAGATCTGCCAGCGCGTCaagccgtcggcgtcgaagcAAGCTCCGCTGCG
TCCGCTGCCCAtcgccacgagcgcgtggcgatCCGTCAGCATGGACTTCGTNAGATGGTCCATCTTGCTCCAGTCGCCGCCCAAGTGACTGCCGAAGATT
CTGCAGCGCTGTTTCTCGACCTGGTGTTCCGCCACCATGGCCTTCCGGAGTCCATAGTCTCGGACCGCGATCCCCGCTTCACCTCCGCGTTCTGGACGCG
GCTGTTCGAACTGCTGGGCGCTCGCCTGCTCATGTCAACGGCGGCCCATCCTGCCACTGGCCGAGTTCGCCATGAACAACGCCTTCATGCGTCCACGGGC
TTGACCCGTTCTTCGTGAACAACGCGCGTCATCCGCGCGTTCCGGCGCTGCTTGCCATCCGCGCTCCGGACACACCACCGGGCTCCACCCTTGGTGggga
ggagctgcagcagcaccgacacaGTCGGCGCTAACATCGAGTGTTCTCCCGCCGATTCCAGCCAGTACCCNCTTCCTGATAACCGGCTGCATACCGGTAC
CCCGACCGGTACTCCGCACTCACGGAGTACgtctgcgccaccagctgagcagcacgcgcttcacGGAGTCGCGCGTCAACCGAGTCCGGTCACGACTGAC
GCGGCGCGGAGCGCCGCGTCCAAACCAAGTGTTGCCAACTTCGCGCCGAAAGAGACTCCGACGCCGATCGACTCGGCAGCAGTGTGGtcgacttcctgct
gcatcaCCAGGCTGTCACGCGCTTCGTACGTGACGCCCTCCAAGCCGCCGTGGACACTCAGAAAGCGAATGCCGATCGACGGGGACGGAAGAACATGTTG
TCCTTCCGGCGAAGCGAACAAGTGCTGTTATCCACGGACGGCATCCAAGGCACCGCGGTGACCAACTTGGGTGCGAACAAGCTCGCGCCACGCTTCATCG
GACCGTTCAAGATT