Description :
From Genome Similarity Track
Location :
contig_66:159988- 161484
Transcript NameFunction/comments
g11839.t1hypothetical protein
g11840.t1XP_009534226.1 hypothetical protein PHYSODRAFT_523326 [Phytophthora sojae
g11841.t1hypothetical protein

Sequence
1496 bases(100 bases per row)
ACGTGATTGAAGATGTAGCCATCGCACCGAGCTACTTCAGCTAAGCACGATGCATCTTTCTGCTTATATGTTAATCGAATGGAAGCATATAACTTGACGA
ACAATGGCGGGTGCCAAAAGCAAACGCAACTTCAACTTTCCTGCTCTTATAGAGAGTTTTTCTTGTAGAGGACCAGAGTCCCGAATTTTGATTCGGATTT
TGATTATTTTGGGTGGTTACCCTGGACTCCCCCATAGTGAGTTCGAGTCTGACAGAGCCCGAGGAATCGCCGTGGCGTAACCGGGTACAGTCTTCAGGTC
AAGCGGCTTCAAGCTTCGCGCGCTCGTCGGAGCCAGATCTCCCTGCCGCCATGGTGGGCAACAAGCACAAGAACGGCATCATCTGCACGTTCCCGGACTG
CAACAGGCCCATGCGCACGCAGAAGTTTAAGATGCACTTCTCCAAGAAGCACCTGAAGGAAGGCGAGGTCTACTCGGTGGAGCATCGGCGCCAGTACGAG
GTGGCGAGGGAGGACAATGTCCGTACTATCGTGAAGCATGAACTTATCCCCGCCACCGCTACCACTGCAGCACCGACGCTGTCGTCGGTGGAAGAGGTTT
CTCGCACGGAGACCACGAACGCATCGGTGATCTCAACTGCTGCTGTTGCTGCTGCACACGAGGCAATCCAGACTCAGGCGAAGGAGCTCGCCCTGCTTCA
GTCACAGCAGACACAGCTTGCCTCGCACTACGTAGCCTCTGATGTCAAGACGGAAGAAGCCGGTGACGCAGTGTCGCCGCCTGTCTCCGCCAACACGGCT
TCCGTGTTGTCAGCAACCTCTGCTGAACAAACTAGCGGCAGCAAACGCCTGGCGTCGGCAATGGAAACCTCCCAAGGCGCCATCGATCCAACAAGCGCGT
TGCTGATGCAGTTCATAGCGCTGATGGACCAGCGGTTCCAGGAGCTTGTAGGCAAGATGGGCGAAATGATCGACGTGCAGAAGGATCTAATCGATACACT
TCAAGCCAGCAACCCGAACGGACAGGCCCCAGCGTCAGCTTTCTCGTCCGCCGTCGAAGTGATCATGAAGAGACGGAAAACAGAAATGAGCCCTAGCGGC
AATGAAAATGGCAAAGCCGAGACCAATGTCGAGACCCAAGGACTTGGTAACAACGGTGTCGTCTTGTAGACAGCGTGACGAGAATTGACTTCCTTGATAT
AACCTTTACCTCGCATCAAAGTTGCGCTCCCAATGTCAAAGTAGCTCAAGGTAATGAAACCCAATTTACTCAATGTCAAAGTATGTCAAAGTAGCCATTT
CGTCGACTGTCAATGTAGCCATTTCGTCGACTGGTCGTGGTGTGCACCACACCTCGCCGTCTTCCAACCAATTCGCGCTAACAAGCAAAAAGAATGAGTG
AGCAAGCGGTGGAAGCGTTCGGCAGCGTGGAGCAGACACTGGCGGCGGTAGAGGAGCATCTGGCCGTATTCAAGCAGACCTCAATGGAGGACTTTG