Description :
From Genome Similarity Track
Location :
scaffold_76:159919- 161607
Transcript NameFunction/comments
g7383.t1 EF-1 guanine nucleotide exchange domain-containing protein, putative
g7384.t1 hypothetical protein PHYSODRAFT_320696
g7385.t1 hypothetical protein PHYSODRAFT_472002

Sequence
1688 bases(100 bases per row)
CGACCTTCGGGGCGGGGGCGGCCTTCTTAGGGGCCGGAGCCGCCTTCTTAACGGGAGCAGCCTTCTTAGCGGCGGCGATAGCCTTCATGGGCTTGGCGCC
CTTGATGGGGTGCAGCACCGAGAACTTGGCGGTCTGCACCAGCTGGAACTTGTTCATGTCGGTCGGCATTTTCACGTAAGGAAGTCGATTCGCTACTGAG
GAATTGGCGAAGGTTTTGGCTGTAGGGGTAGAATTGTGGCCATCCGTTTCTATTGTGATATTTAATGGCAAAATCAGGTTAGTGGACACATTTTCACAGT
AGCATTTTGTGCAATAATGAACGAGTTGCAGCGCGTGCTGGACGCGTATCGCGGCATGGAGCCCGTGCGCGACCTCGTTGCCAGGATCAAGACGCAGTTT
GCGGACGAGCAGCGCTGGGCGACGCTGGAATTCCAGGTGGGCAGCGGTATTTTTGACATTGGAAATGGTGGCACAACTCACGTGTCAATCATTGGCTGCA
GGCTCAGGTGATGCACGTGGTGGTGAACGACCCCGTGTGCGACGACTTCCCACCGCAGCGGAAGTACACGTACAGGTTCCTCAAGCGCTACTTGGACGGT
ATGCATCAGACAAAACATTTTTCACATTTTGGTGAACTATCGGAGACGGTCGCCATTTTCGAGTGACCATTGTTGGTCTCTACCGTTGCAAGGTCTGATC
AATGTTGTTGCCGTGCATTTTTGTCGACAGAGATTGAGGCGGTGCAGGCGGATGCCGATGACGGACTCGTCGAGGCACTCATGGAATTTGTACTGAACGC
CAAGCTGGCCGATGACTCGCTCAATGCTGAGGCAATGCACCACGTTTCGTACACGGTGCCGACTACCGACTCGTCCGTTGTCGTGTCCTGCCGAGTAGCG
TCCGTGTTCAACGAGGTCGGGCTCAAGCTCTGGGAAGCAGGATGGCTGCTCGCGGAGTACATCATCGCCCACGAAAGCGAGTTCCGCGACAGGACAGTGC
TCGAACTAGGAGCGGGTGTAGGCTTTACCGGGATGGTTCTGGCCTGCGTGTGTCGCTCAGACCGCATTGTGCTCACGGACTACGCGCCCAACGTCATGCA
GAACCTGCGTTACAATGTAGAGATCAACGCCAGCAAGTTTCTGTGCCCGGTCGAGGTGCAGACGCTAGACTGGGAGACATGGCAACCCGAAGACCACGAC
GACGAGCGGCCCGACGTGCTACTTGCAGGAGACTGTGCCTACGACGTTGCGGTATTTCCTGCTCTGATGCGCGTCCTTCAGTCGTTCCTCGGCAACGACG
GAGGCAGCACGACCCAGCACCCTCAGCGCGTAGCAATTTTCGCGGCCACCATTCGCAACCAGAAAACATTCCAGACATTCCTCGACCAGCTAGCACAAAA
CCGCATTGACTACGTCGATATCACGGCTTCCTCGGGTGGACAGGTCTTCTCGTACCCGAACCGAGAGCAGATTCGCATTTGTCGCCTCTCGAGATCCATT
CTCGACGAGGACGCACCTGCAGAAACGAAATAGTTTTTGTTTGTCGTATATTCGTGTTACATGGAGTGCATCTTGACCCTGAAGAAGAACACGCAGACGA
TGAACGCTAGCAAGCTGACAGCGCCGCCTACGAAGACAGGTAATCTGTAGCCCATTGATGTATCCACCAGCGCAGAACCGACGATGAA