Description :
From Genome Similarity Track
Location :
Scaffold_257:1599- 4887
Transcript NameFunction/comments
Physo_144760reverse transcriptase
Physo_144761hypothetical protein

Sequence
3288 bases(100 bases per row)
CCCCACTCGCTCTTCTCGACACTGATGGACAAGTGCCACTGCTCGCAGACACCCAGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTGCCCC
CGATGAGGATGTCGTCGATGTACGACCTCCGTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAAACGTCCCGAGTACTGCCATC
CGGGGACAGCTTCATGAACCCGTAGAGCGCGTTGTCGATCAAGCGTTGGTAAATCTGTGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTAC
AGTCCCATCGGCGTGATGAAGGCTGAGGTGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCAAAGGAGCAGTACCACAGAT
ACTTGTCCAAGTCTTCGAGCAAGTCGCTGACGAGCGGCATGGGGTAAATCATCAACTGTGTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGAT
ATCGACGCCGTTCTTCTTTATGATCACGACAATGGGCGACGCCCACGGCGACTTCGACTTCTTTTGGATCATCCTCGCGCTCAGCAGCCCTTTGATCAAG
TCGGCGACCTTCTCTCGAAACTGCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCGCGTCGATGTCGCAGACAACACCCAGGGCGG
CCGGCGACAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGTG
TCCAGTTGGCATACCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAG
AGGTCGGACCCCTCGTGGATGAGGACCGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTT
TTGGCTCGGCGAGTTCCGACTCCGGCGATTCTTCCATCGCAGCGCTTCCAGCCACAGTCGGAGGCATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGT
ATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCCTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGGTCACGGCGCGTCACGTCACGACT
TGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCTCGT
CGCGCCGTGCGCCAGATTCTGCCACTGCTGGTACCGGGTGGTGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCAGTCAGACGGCGTCCACCACCCA
AGCGTTTCATGCGCGTCGAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGACAAAGGTAGTCACCC
ACGACTCTGCCCGTGTCACCCACAGGAACGGCGCGTTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGAC
GTTGACCGGGTGCATCCGTGTGCCGTATAGCGGTCTTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCATCCGCAGTGTCGATG
CGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCA
AGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTC
ACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTG
TACCACTTGTGCGGCGCGTAATGTGTCCAGTATCCGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCG
TCGTACGTCGGACCGCCGAGATTCGCGGCGCGCGTCTTGCGTGGTACGTTCCGGGTTGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTA
ACCACCTCTCGCGACTTCTTAGTCACATATGCATAGACGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAGTTTAACATCTT
CTCAGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGGGTCAAACCACTGGCGCAATTGGTTGAAGAACGCCTCCATCGGGCATTCTCCGGCTTCGTGC
ACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGCTGGCCACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTATACAT
GGCGACGTGAACCACAGTGGCGGCACCGCAGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGC
GACGAACAACTTGGCGCGCGCCGGCTGAGTCGGCAGGGTCGGCGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTCTTTTTCTGGTACGTTGTCAGG
CACGCAGTTTCTTCTCCAGCGCCTCGGAGTCGGCGACCTCCATCAGCGTGAGACGTGAGGTGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATG
CTTGACGTTTTCGCGCTTCTCTTCAGTCGTGCCCTCGGCGTATGGGATGTTGGCCCTCAAGCCCGCGACGTTGAGCCGGTACAAGTAATCCAGAGGGGTC
TCGTCGGGGCGCTGAGCCGCGTGGTAGTAGCGACTGGCCATTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCATGATT
TCTTGACCTTCCTGGGCAACTGGAGATACCATTGGCGCGCAGGGCCGCTCATTAGATCGCTGAACTGCCCGCACACTTTTTCGCCCGTCATCCCGTCGCA
CCGCGCGGCGGACTTCCGATGGTTGAGCCACAGTCTGGCTTTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGT
ACGCGGGCGAGGGCTACGCCGCCGGCTGTCGCCGTCGAGACGGTGGCCGCGGTTCTTGGCACTCCGATGTCCAAGTCGAACAGGTCAT