Description :
From Genome Similarity Track
Location :
Scaffold_2365:1599- 2934
Sequence
1335 bases(100 bases per row)
GCCAATGTAGTTCCGGTTCTTGAGGGCGGGAAGGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTC
TACCTTCTATGTCTTTCCCTCGTTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCA
CCGGATCCATGGCGTAATCATTATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACTGTAAGTGAACACTCGTCGT
GGATCTGAGCTCTCCAATCATCCAACTTCATCTCGCAACCGTCTGTGATCTCCATTGTCCCACGAAGTTCGAGATCCACTGCATCCGTCATCCCTATACC
CTGGATCCAGGTCCCTCAAGGCGGGATCCTCCCTCCATGGATCCGAACTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCCTCATTAG
CCGTGGCTACTAGATCCACCTTCAAAGGGCACCTTACCATCCTTCTTCGTAGGATTTACACCCGATCCACTCTTGTATAGTATATCCCATATCCATTTAA
GTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATACCAGATCCATCGTCATTTCATACGGGGTGCTG
CTCGTCATGGCTAATCCACCACCGGCAACTTGCATCCGTGCCACCAACCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGAATAGTGACCCC
GCGTTAGGCCCATTCTCTTATTTCTGAGACAGCACTTCACCACAATCGCCTCCTGTACGTTGTCGGCGCTGCACAACAGCGTTCACGGCGTGCATTACCA
GCATCCACAACCGCTTTCTCCCCTTCGCGACACATGTCTCCCGCCAAGCGTACCGGCAAATCGTCGGGCAAGGCCCCATCCACCACCCCTCCGGTCAGTC
CGTCTTCTATGTCGCTCACCGATCTGCGGGTTCTAGCCCAGGCTCTTTCCGATCAGGTGCAAACCCTGACGGCGGAGCTCCAGACGGCTCAAGATGCCCA
AGACCAAGCTGCGTCTCTGCACACTACCCAACTTCAGACCTTGCGAGCCCAAGTCCATGACCAGGCCATGGAGATCCAGGGGTGGGAGCACCGTGCGGCC
TCTCGGTCGCAGGACCTGCGACTCTTGTTAGCTGATCAGGCGGTCGAGATCTGCGACCTGACCGGACGGCTGGATCGCGCCTCCCGTCAGCGAGATGTCA
TGCGAGATGACAACGACCATCTCCTTAGGGAGATG