Description :
From Genome Similarity Track
Location :
Scaffold_326:15988- 18220
Sequence
2232 bases(100 bases per row)
GACAGGGGTGTACGTTATAGAATTGGCCTGGTTCCTGGAACCAAATATTGCGCTAAACTGTAATGGCCTTTACTAAAGAACACTGCGATGTTATCGATGA
ATTCTTTCGTGCAGAGCGCGCGGCAGGCATACTTCGCGAAAGTGAATTCCCTCACTCTACGACCATCTTCTGTGTGAGGAAGCCAAATGGTACGTGGCGC
ATTGTACACGCTTAGAAAAAATCAATGCCGCTACAATTTCAGCGCAAACATCGCTAATAAAACGGATGTTCTCCGAAATATATGGTTGGTTGCACGATGT
AAACTGCACTTGACCTGGTCGATGGTTATCAACGATTACTCATGCGAGCGAGCTATATTCCACCCACAGCGGTTATAAACCCGAGTGGTATGCTTTGGGA
GCTGCTAATTATACATCAGAGGATATATAATTCCCTGGCGACTTTTAATCGTCCTGTGGCACATTTGTTCCGTTCTCACCGATGTTATGCACATACTTAT
TTTGATGACTTCTTATCCGTAGTCGAGCAGAAAACGGGAAGGCAGATGTGGAAAATCACATCGACCACTTGCGAGCAGTGCTCGAGTGCATGAGCATTAA
TAAGCTATGTGCCGATCCATCGAAATGCGTATTTGGTGCTATAGAGATAACCTTTCTGGGATGCTCCATACGATAGCGTGGACTAAGGGCTGAATCTGTA
CATGTTAAGGCCATATTTGATTGGCCGGTCCCTCAGAACCGGAAGGACTTGCGTTGATGGCTTGGCCTTGCAAATCCCTGCACAAATGTAGTGCAAATTA
CGCTAATATGGAAAAGCCATTGTCCAATCTCCTGAAAAAGGATACAGAATGGTTCCAGAGTAGCGTTGAATATGAGGCTTTTACTGCCGTAAAAAAGATT
CTCTTTTATGCATCGATTTTGGCCCTGCCTGATCCGGCGAGGCATTTTTACTGTCGTCTGTGACGCATACGACTTTGCTATTGGCAGCTCTCTGTCACAA
ACATATGAGGAAGGACGTGAGTGTGTCATCTCCTTTGAGTCTGGCCAGCTTAAAAGCAGCTGAAAAGAACTATCCATTTCATGAAAATAAGTTATTAGCT
ATGAAGTATTTTCTCTAGTCAATTTTAGCGTACATCTGCTGGGCTCGAAGCCATTTGTGATCTTTATTGATCATGCGTCACTACGCACTGCCACACAGTC
CCCCTCACCTCTCACAGAAATTAGACCGTTGGTTGTCATTGTTTGTGGAATACAACTTCGGGGTGAAATACAAGCCTGGAAAACAGAACGCTTTGGCAGA
TGCGGTATCACGCATACCTGGATATGTGCTTGCTTATGTTACAACATTGTCGTCCTACAATTTCCGACTTGACTCGTGTAGCTTATGCCCTTGATGATCA
CTATAAAGCTTTGCTATGTGCTCTCGGAAGCGAGGAGTTTGAAGACTCGGGCTAGAAATTGTCGGCACGATTGCGTGCGCGCCTCCACCGATATAGTCTC
AGTCCGAGTCTCTTGTGCTATCGCATAGATAATGAGGATAGTCCTCGCATTGTGGATTCACGTGATGAGGAGTTACAGTATCTCATTCTTTACTAGGCAC
GTAAACGACGATAAGCGGTCATTTTGGTCTTGATACGACCTATCACTTATTGAGTCAGAGTTAATGGTATCCCATATATATATATATGCGGAGGGTTTGA
CCCGTTGGCACATGCTGCTGCACCACTAGCGAGTCTACCTGTCCCCAAAGGGTATTGAGAGTCCATGAGCATGGATTGTGGTTTGGCCGTACAAAATATT
CGGATGGCAGCACAAATATTGTCGCATGTGTTGACCGCTTAAGCGAGATGGCTCAGTTAGAGGATGTACCAGAAGCAATTGGCGATAAAGTTACAGCTCA
GATGTTTATCGATTGCGTGTTTCGCCAACATGGATTGCCTCGAGAAATTGTTTCTGACCGCGATCACGTTTCACGGGACAATTTTGGAAGTCCATCTTCC
AGGATTTTGGTACTCGTTTGTACATGTCCGCCGCCGATCATCCGCTGAATAATGGTCAAATCGAACGCGTTAATCGCGTTGTGGAATATATTCTACGTAG
CATATGTGCCGACGCACCACGGCATTGGGGCTCGATACCCCCTGTTGTTGAGTTTTCTCTCAATAACGCTGCGCAAGACTCTACGGGCTAAATACCATTT
TACTTCAGCGTCCTCACGCACCGCGCGTACCG