Description :
From Genome Similarity Track
Location :
contig_113:15988- 18130
Transcript NameFunction/comments
g11258.t1hypothetical protein

Sequence
2142 bases(100 bases per row)
TCCGGGACATCCCGGAGGAGTGCGGCGCGAGGCTCCCACGTATCTTCGTCCGGAGGGAACCCGAGCCAGCGTACTCGGTAACGTCGCGCGGTCGGAACCG
CGTGCTTGGAGCGCGTACTCGTACGGGTATGGGCATACGTACGAGGTGGATCTTCGTGCTCCACAATACGGTCCACGATCCAGCGGATATCACCAGCCGA
GTCTACAATCGGCGGGGGACCTTCGCGACGATAGAGCTCGCGTCCTGGTCGCCCAGGATGACGTGGACGAGGCAGTGAATTGGGCGCGGACGCTCAGCTT
GATGCTGAGGCGGCGGAGGAGCGGGCTCGTCGGGCGAGGGTGCAGCATCGGCTGCTCGCCAAACGAGTGCGGAACTGCTGCAACGGACGCGGGAGCTGGA
AAGGCGCGTGTTTGGGGCGCCGCAGACGGCAGCACGTCCGCGCGAGCGGACGGATGGCTCGGATAGCTCGATGGCAAGGCGCGCACGTCGGGAGGGACGT
CCTGTTCATGCTGCGCCGGCGGATGCTCCGGAGCCGACGGGATTGTAGCTGCGTGGTATTTCTTGAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAG
GGAAAATGGTATGCCCAGTGTGTAGGCATCACCGATTACCTTCGTAACCCTGAAGGGACCAATAAAGCGCGGCGCGAGTTTGCTCGTGCCAAGATTCGTT
ACGGCCGAAGAGCGTATGCCGTCTGTCGACAGGAGCACGCGATCTCCTGTCGTAAATGTAGCCACGTTCTTGCGCCCACGCTTGTCGGCGTTCTCCTTCT
GCTTATCCACTGCTTCTTGCAGTGCATCTCGTGCAAATCGGGTGACCGATTGTCGCTGCAGCACGAACTCAGAGACGGCCGCATCATCGACTGGACGCGC
CGGAGGCTTCGGCGCGTAGTTAGCTGCGACGGGATCGGTAGCCGGGCCAGGGTTGATTAACGTGCGCGCAGTCCAATCTGTCAGTGAACACACCGCGTTG
TTCGGCGTCGCAAGGGTCCGTCTCGACTTCGCGCGGGTGACTGCATTCAGCGTCACGGACTGGTGGGCTGCACTCGACAAGGGAGCTGGTGGTTGTGGTG
TGCCATCCGTGCTCACCACTGGTAATACCGGTATCAGTATCGGTGTGTCTGTGTTCGTACTACCAGCACCATCATTTCCTTCCCCACCCAGAGTGGAGCC
ACGAGGCATCGTGGGGAGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAGGGGGTCAGACCCGTCGATGCGTGTTCT
GCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAGGACATCTTCGAGGACTCGGTTGACCC
GCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGACTCGACCAGAATGCCGACGTGAACCG
CGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGGACTCAGCCGCGGTGATCGTGTCGGAC
ACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGACCGTCGGCATCGGGTGGAAGCCCGAAGATGAAGTCCATCG
ACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACGGCTTCACGCGCTGGCAAATCTCACAAGTACGGAC
CCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGCCCAAGTGACCACCGACAGGGCTGTCG
TGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATCGATGCTGTACGTCAGCAGATCGCCGT
CGAGTTGATATCGGTTAATCTGATTGCGCGTGTTGTTCGGCAGCGCGTGGAGTGTTTTATCACTGGGGGAAAGAAGATGTGCGAGGATGGCGGCATATAC
CGCGTCGTCGTTGTACGCAACGGCAATTTCTTCGCGTAGCGG