Description :
From Genome Similarity Track
Location :
Scaffold_127:15988- 17343
Sequence
1355 bases(100 bases per row)
TCCGTGATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTGTTCTGCTGCGGAGACATA
AGGAGACGACGATCGGTACCCCGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGACTGTCCGCGATC
ACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTGTCTGGATCACATCGAGATCCTGATTGAAAAGATCATTCGCTTCAAAGGCGCCAG
CCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGTCACTCGGGGGGGCGATATCGGGCCCTTCGGGTCGTC
GATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCCGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGACCAG
TCAAACGCCGACGGTCTGGGATCTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCGTCACAATCTGGTCCTTGTCCGCGATCGCGTCCAGGTAGTCCG
AATCGAGCCAGATCGGCGAGTCGGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCGGGGT
CCCCGATGGGACCTGGGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCAACAGAAGTCCTCCGAGCACTCTGTCGA
TCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGTATCTTCTACGGACT
CACGGTGAAATTCGGAGTCACCAAGAGATCCAGGCACGCGCACTATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCTTGATCGAGCTTCCCAC
CAGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCAAGACCCAACGATCCGCGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGACGGGCTGGA
TCTGCTCTCTCGGGGCTCCGACGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGAGCAGCGCGGTAGTCTTCGCTC
TGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTGCGATCGGTCGGCCTGGAGTTGATCTAAGGCCTGTGGTTGCCTTTTCGGGTGTGTTCCTTCC
TTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA