Description :
From Genome Similarity Track
Location :
Scaffold_8:159874- 161356
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03159ankyrin repeat protein
Sappa_CBS223.65SPRG_03160protein transport protein SEC13 putative

Sequence
1482 bases(100 bases per row)
GGCAGCGTTCGAGGCCGTCCTCGGGCCGGTCCGGGACGCCCTCCGGCATGCCGAGCCGCCACCGCTCTTGCCACTCTACAATTTTGATGTGCACGCGCCG
GCGCGCCGCGTGTTTATCTACTACACGGCGCAGGACCCGTCGTTCCTCCGCCGCATCGAAGTGAGCGTCCAAGCCAAAGGGTTTGTGCCACTCCTGGCGT
CCCAGCCCTTGGATACGATGGACGTGCGCGAAGAAGCGGACGTGATGACGTCGTCGTCGACGGTCGTCTTCCTCGTGACGACGGACGAGCTCGGAGACAA
CGACGACGCGTGGCGGAATCTGCAAAAGAGCTACTCGATCGCCAAGACGCACGGCAAGACGATCGTGCCGGTATTTGTGGGGCCGCAGTGCTTGGACTTT
AGCAAGCTCTACAGTCTCTGCCGGACGCCGTGGCACCCGTTTGTGGCCCAGCGCGGGTTCGAAGCCAACTTTAGCCACCTCACGAAGCGCCTCAACGACA
TGCTACCGATGGGCTTGGCGCTCGTGAGTAAGCGGCCGCGGTCTGGCTCGGACACGGTGTACGTCACAATGCCCTTCTCGCGCAAGAGTGACCCGTCCTT
CGTCTCGGCGTTTGTGTAGCTTTTTATATAGTCGCTCGTGCACTCGTACATGTATGATCGTATCTTTTGGTTTGACGTCTTGACGCATGCGCTTGCTGGT
GACGGTGCTGGCGGCTCCGGCTTGCACTGACGTTTGTACCATGATACCTCCATGCGCATGCGATCCAGCGCCTACCAAGGACTCTCGGCATCATGGCGCT
GCGGCTAGGCTAGGCGAAGCTCTCCATACGGCCGGCTACGTGGCGCGTTGCCCGTCCGCGCCGCTTGGCCGACGGCCGCGCCGTGCTGGCCGCGCCGATT
TTGGTGGCGCCGTGTGATTGGCTATAAATCTGTTACGTACGCTCCATAATAATTTAACAAATACATACAAAAAGCAAGGTAAATCCCATGCATTTAATAG
CGGGGCAGGTGCAGGGCGCACTTTATCGGGTGACTCGCCTTGGGTCTGTGTGGTATCTCCAGTCAGTAACAACATCCGTTCGAACGGCAGCAAGCTCCAT
GGCGGCCCCGGCGCTCTCGATCGACACGCAGCATGACGACATGATCGTACGTCGAACATGCTCCTGGCGATGATCCTACATGCATGGCTCATGCGCGCCA
CGTAGCATGATGCGCAATTGGACTACTACGGCAAGCGGCTCGCGACGTGCTCGTCGGACCGGACCATCAAGGTCTACGATGTCACGGCCGACGCCCAGCA
CACGAACGAGCGCGTCTTGGCAGGGTACGAAGCCAATGAGAAAGCGATGACTGGATATGCTAAGCGGTGCGTAGCCACGAAGGCCCCGTGTGGCAGATCA
GTTGGGCGCACCCCAAGTTTGGCACGCTCCTCGCGTCGTGCTCGTACGACGGCAAGGTCATCATCCACAAAGAAGCCCAGCA