Description :
From Genome Similarity Track
Location :
Scaffold_57:159862- 160874
Sequence
1012 bases(100 bases per row)
CTTCTTTGCGGAGTACAACTTCTCCGTGAAGTACAAACCCGGACGACTTAATGTCGTCGCGGACGCGTTGTCGCGCCGACCCGATTTCGAGTCGGCTGCG
CATTCCAACAGTGAGGTTGATACCACTGTTGCAACACTCGTCACTGGTTTTCTGTCGTCAACATTGCTTGACGACATAAAAAAGGCCTACTCAGAACATA
AGGCTCTTCTGAGACTAATGGATCATCTGGTGACTCCATTTCGTAAATCGCTCAAAGATTTATCGGCCTTGTATCGATCTTCCGCGGATTGATACACCAC
GCAACGGGTTGCTGTATTATACAACCATTACCGGCGACACAACTCGTGTCGTCGTCCTCACTAATGATTTACGCTTGCGCATCTTGTATGAGTGCCATGA
TGCACCCACTATCTAGTGGGCATCGTGAGCGTGAGAAGACTTATCTCACGGTAAGTTGCGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGCGCAAGTA
CATTCGTGCTTGTGAAGTGTGCCAACGGGTGAAGCCCTGTCCTTCATCCCGTGCGCCACTACAGACTCAACCAATCCCGAATGAGTGCTGGCACTCCGTT
TCAATGGACTTCATCTTCGGTTTCCCCTAATACGCTCACAAGAATAATGGTATTCTTGTGTTCGTAGACCGATTCAACAAGATGGTACATCTTGCTGCAG
TAAATGAGTCAATCTCAGCACAAGGTTGTGCCCGTGTCTTCATTGAAACGGTATTCCGACTCCACGGTCTATCCCGTGAACAAGTCTCTGATAGAGATCC
TCGGTTCACGGCGACGTTTTGGCAATCCGTGTTCTGATCCTCGGAACACGTCTGACTATGTCTACTTCTGACCATTCCGAGACTGATGGTCATACAGAAC
GCGTCATTACGTCCTTGAAAAATACTTAGAGGATACGTCCAATCATTCACAGATCGGAGCGAATTTTTGCCGATGGTGGAGTTTGCTATCGACAACTCCG
TGCATGCATCGA