Description :
From Genome Similarity Track
Location :
Scaffold_521:15985- 19137
Sequence
3152 bases(100 bases per row)
TGACCTCGTCGGACATCACGGCGATTTCTTCCTCTTCTGGGATCGCGTGGGTGCGGAACGCGCCCGGGTGCCTCGATGGCTGGTGGCTGCGGAGGTGATG
CATGTCTGTCTCCTTCTGTAGTCGTACGCAATCAGCAATAGCAGGTGAAGCGCTGAACTTGTTTCATTCGCTTCTGTGGCCACCGTTTGTACACTCGAGA
GTTCGCCAAGTGTTGATGCGATCGGCGAAGAGTAGACTGACAAATGGAGACCGCTGAGGTGGGGCGCGGGCTGGCGCGTTTGGCCGGCTGACGTGTGACG
TGTGCTGCGTGGGCGAGTGAGGCTATGAAATCCTCACACCTGGGCCAGTTGGTCATGAAGAAGAAGAAGCAGAAGGAGAACGCGTCCACCGAACCGTTGG
AGACCGAGGTCTCAATTGAGCTCTGCGCTGATACAAAAAATGCGAGCATAAACCAGCCATTTTGAATCTTCGACATGGCCCGTCTCCAATCCGTGTCATG
TGCGACCTTTGCCGCGTGACTGACTCTTTGACCTCTACAATTGAGTAAATGTGAGCACTATATACAATTTACACATTGTTATTTCTAGCATATTTTTAAT
ATTATTAAAAAGGGTAAACTGAAGCAACTGATGTTGAAGTGAGTGACACCATTGGTTGGCACTCATCGTGCCTCATTCTTCCAAACGAATCTCGTTTTAT
GAGCCTCTCGCCAATGCGAGGAGCTACAACTGGACGGAATCAAATCTCTTGGTGGCGTTGCCGTGGTTACTCGTTCGCTGCTTCGGTGCAAAAGTACAGC
GAAAACACGGCTAGTCTGCGCTGAAACTGAGCCTATGCAGGAGCTCTGACAAGCTGCAGGTATGATGCTCATTCCATACAGGTAGGTTGTCATAACTTCG
ACAGTGAGACTCAAATGGCTATCTGCTTGGTCTGGACACTTCCACATCCATTTCTCATTTTGCTTGCGTGTGTCCATTTCAGTCCAGTACTCTCCGTGGG
AAAAGCGCATCCGTCCACATTCGGAGCTCCTGAGCAGGTCCAGCAGGTAGGTATTACTTCAACGTCCATCCATCCGCGGCGTCGGCCAACGCTATGATTG
CTCACTGGTGGTCATCGATACACGCTGTTACTGACCGCCGGAGCCTGGTTCAGACGCCTCACGCGCGGACTCTGCATCGAAATCTTGAGTGGCACCTGAA
GCAGCATGCTGCTGCTGGTCAGACTGCTGGATGAGAGCGCCACCTCGGACGGTCGTATGGTAATGCGGTCATCGTCTAGTGTCTGCTGCATGTGAGTACC
TTCGAGATGCGGCGGTGAGCGCACGGTTTGGCTCGACTGGGACGCGTTTCGAAACGTGCCGATGGAGCGCAGCTGATTACGAGCGGCTTCGCTGTTGCTG
GCTCCAGCCCCAGCACTACCAATCGGAAACGAGCTTTGCCGTTGCTGCTGCTGCTGAACTCCGAGCACTTGCTCGCCTCGCTTCGGCTGCAAAGGGCGAA
GCGGAACGTAGGACGACGAAGGCGAGCGGTGCACGCCATGCTCAGCATATTGGCGCGTCATCTCTAATACAACCTCCTTGTCGTCCAGAAACACGTCATC
GTCTCTTTCGTGAGCCTCGCCGATGTAGTCCTCGTTCTCTCCATCCAGTAGATCATCCATATTGCCTGCACCACCGCTTCTTTGAAGCGACGGGCGCTTG
GAAAGCGGGGTAACTGCGCTCTTGCCGCTGCCTTTCGACTGCCGCGTGCGGAACAACTGCTCGACCTGGCTCATGATCGGGCTCTTCGACAGCAGCTTCT
GCACCGCCTCGATCGCGATCTCGGGCGTCGAAGTCAGCACGCCGTCGACGCCTGTGAGCTGCAGCAGCAGGATCTCCACGATCTGTAGATCCTTCTCCGT
CGCGCGCTCTTTGTCCGTCGCCGCCTTTGCGATAATGCCAGCACCGCTGAAGGTGCTCACCCGGTGGGGATGGAGCTTCTGTGGCGACGCTGTGTTTGCG
AGCCGCTTGCTGCTCCGCTTCCGGTTGCCGCCGAGGCTTCTCGTACTACTGGTGCTACTGATGTTGTTGTTGTTGTTGCTAGTGCTGGTATCCCCGTTAC
CAGCCGCAGTCTTTTCCTCTCGCGCCACAAACACTCTGAGGCCATAGTACTTTGCCTGTAGGAAGAGCACTTCGTTTCCCTTAGCCGAGTTGCTCAGCAG
CATCTCCTGGTCGAACAGCAAGATGTCGGCGTACCGCGCGTACCAACTCACGCGTCGCATGTGATGCCTCGGTGGCAGCGACGCCGAGCGTCGGCAGTCC
TTGATGAGCGTCCAGAGCGGCTGCCGCTTGCGAAAGAAGTCTAGGACACTCGTCTGTCGCGAGAGGAGGCACACGCGTTCGTCCGCGACCTCGCTCACGC
GCAGCGCGGCCACAAGACGCACCCAGAGTAGTCGTAGCTCGTCAGGACTTTTGCGTTGTAAGTGGAATGATGGTTGTGATGATGTGGAGGTGTAGGAATA
GATCTCTTCGTCGGGGAACTGGATGATCACACTCGGTGACGCCTTCACTTGCTGTCTCTTGTCTGCAATCGCTCGAGCACTTAAATGTACGCTCAGCTCG
GTTTGGAACCTTGTGAGTGCCTCCGAGAGCGTCAGCGCGCCCATCGCGGATTTTTTCACGTGCTTGACCACTTGAGGAAAACGTTTGCGGTTAGAGCTCA
CTTGGGCTGCAGCTACACCATTGGTGGAGCCCACGATTCCGTTGCCAATAGTAGTTGTGGTAGAGCTATTTGGTATCGTAATCCCTTCAAACGGGGAGGC
TGAGCTGCTGCTCATGCTCAATGTGGGCAACTGAATCGGGAGGTTGACCGCCATGCGCTGTCTCGAGTTGCTGCTGCTGCCAGAGCCTCCCACACTGCTG
TTGCTACCCTGAGAGGAAGACAAAGAGGACGCCGCATCATCGAGGAGCACGAGTTTCTGGTCTCGCAGCGTATGTAGCGACAGCAGCAGCGCCGCAGTCG
CGTCTTCTTCCGCGCAGCTGTTCTTGCGCATCAACACGCTCGAATGCGGCGAGCTCAGCAGTGACGGGCGTCTGCTTTTCCTCACTTTGCGCTCGTGGTT
TCGCACAAAAGCGTCCAGCTGAGCGCCGAGCACCACCAGATGTCCGTCAAGA