Description :
From Genome Similarity Track
Location :
Scaffold_252:15980- 17605
Sequence
1625 bases(100 bases per row)
CTGCTTTTGCTTTGCTAGTACGATTAGTTTAGGGATTCGGCAAATTTCCCGAATCACCAGTACTTCTTGTCAAATCTTGCTTCGCTGGCAATGCTGATAA
ATTTCTCGACCACCGATGTTCTGATTACGGATTCGCATTATTTTCATGGATTTTGGCTTCGCTAGCGTCGCCTTTAGCGAGCGGAGATAACATTGTGTCG
AACAAAGCTGAATGGAATTATTATCGTTTGACTTTAGTGCTTTTGGAATCAAAGTCAAACGATAATAATTGCATCATTTGGATAAAGGTTACATGAAGAG
AACATTCAAAAGAGCACACGTCGTACGTGAAAGTTATTTCTCGTGGAATGTGTCTTTGAAAATCAAAAGATTGACCGTTGATCAAGCAAGCATTGTTGAC
AAAAACAGACTTTCTTTTATAATTGTGCTGTCATTGGAATGACTGAGCAGGGTGAGTTCCACTGAAAACTGCGCATACACCCTCGATATAAATGAGATAG
CGTCTTTGACCTGAAACGATCAAAATAGCTGAAAAGCCTTCTTTTTGGAGTAGACAGCGCATTACCATAGCTGGGCACCCTGTCGATCGTTCGACGACGA
CAGCACAATTGTTTTGAGCTGCTTCTCTCTGTTTGCGTGTGCGAGCTATTTCGAGCTTGCGAAGTCTCATTCTCTATAGCATAATTTTGACGGCAGACTC
TGTAAAGCCGCAGCAATCCTCAAGCTCACGCAAAAATCGTGAAGTGCGACAAAGCGCTAACTTATGAGCTGAATTTCGTAAAATCTGGATTTGCATTGTA
GGTACAGTGGGTGCATTTAGTATTTCTAACGACCGACTTCTGCCCTCTTCGGCGGGGCCAACACATCCCCAATCGGATGGCCACTACTTACTGGATTCTC
TGGGGGCCAGCCAGTCGGGGTTTATGCTTCTACGAGAGGCCGAGCTCAGCGGTGCCGGGGTTCCCGGTGGTACAACTGAGACTTATGTGTCACACATTTT
TTAACGACCTTGGGTTGGTCGTACGGGGGATCGAACCGGCAATCATTGGATTCGTACGGCTGTGCTTACCCAAGGCACCAGGGGGGAACCCCAGGGATTT
GCACTGGATCTTGTCATGTAAGTGAGATGGCGTCGCAGTAGAGTTTGCACTCTAACTTGTCAATGATCGCTAACCGTACTATTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN