Description :
From Genome Similarity Track
Location :
Scaffold_18:159785- 169133
Transcript NameFunction/comments
Phyra_71418dynein heavy chain
Phyra_43251dynein heavy chain
Phyra_76441dynein heavy chain

Sequence
9348 bases(100 bases per row)
CTAGTTGTCCAGGTTGAGTAAGAACGCGGCGCCCATCATGACCCAGTAGTTGGGCGGTTTGTCGCTCGGGAGCTGCACCGCGATGACGAAGTTGGTCGAG
ATGCCCGTGGTGGACAGCGTGCCCTGCCGCACCGACGTCTTGTAGACTGGACACGGATACATCATGATGCCGCCACTGAGCGTTGGGTTACTGGCGGCTG
CGGATGTGGCTGGCAAGAAATGCACGATGGACATGGATGAGAACATTTCGCCGGGCTTGGCGTCTTCGACAAGTCGACGCGAAGGTGACCACTTTGCACC
TTGCAGCCACAGGCCGTCGACGTAGATGCCATCCGTCGGGCTCTGTGTTAACTGCTGTGCGTTCTCGACGTCCATCACGGTGAAGGTGAAGGCCAGCGAG
TCAATGGCGGTTTGGTATTTTCGCGCAAAGTTCTGTAGCGTGCCTGTCATGAAGCCTTGCGGGAAGAAGAAAACGTTGAGTTGGAACACCACCGGCTCGC
CGTGTAGCAGCCATTGTCGGAAGAATGTGACGCGGTCCAGCAGGTCGCGTACCCACGAAGCTAGCGGTTTGAGCGATGCAAAGCTCACAGAAGACCACAG
TTGCGGCACGCGGCCGTTCAAGAATGCCATGTACATGTTGTCCAAGTCTGAGGACATGACGATGAGTCCGTTGATAGCCTTCTGGATGTCTCTCAAGGAC
GTGCGCATGCGGCGCAAGAGCGTGTTAAACTTGATGACCTCCTGACCCAAAACCGTTGCGAGCGAGTCCATGACAATCGTGCCTGCTACTTCCCGAGTCT
TGAAAGTGGTAGGCCCTGCCTCTTCCACATTGAGATCGACGGGCAGGTTCTCCTGGATGGAGATAGCTAGGTCAAGTACGCGCTGGTCGTTGGACTTGCC
TCCACCACCACCTCCATCTCGCGGCTCAAGGCTCAAGATGAGTTGCATCATATTGGCGCTTTCGTTTCGTTCGTAAGTGACGTTGGCGTTCTCGTGCATA
CCGAAGAGCTCAGGGTTATCGAACGCAGGCAGAGCGCCCAAGTAAGACTGGATACTGCTGTGCGTCAGCTCCGTCGGTACATGATAGATGCCCGACGTCG
AGTACGAGTGACCTGAGGCGAGCACATCCGGTGTGTAGAAGTTGCTAAGGATACTGGTGAGGCAGCGTCGATCCCAGTCGTCAGTCACGCGTCCGCCGTA
GTTGATCTGGCCAGTAACGTATCGAAGTGCGTCCCAGGGAATGATGGGCTGCTCCTCCAAGAATTTGCGCAGACTTGCAAGCGAGGTCTCCAAGTCTGTG
TCGTTGAACTCGTATTTGATGTTCCAGCCGAGAGCACCAAACTTGCGCCGTTCCTGGACAATGGCGTGGAAGAACGTGAGTGCACACAGTAGCGATTTCC
AGACGTAGTCCTTTGGCTGTCCGTCGTCAAAGTTTCCGAGGTAGTGGAAGCCCTCGAGTACGTCCTCGGAGAGCAGGGTGTTGAACGATCGAATCAGATT
CGCGCGAATGCCCTTGGGCGGCTCATTCGTCAGCTTAATGCCATTCTGCAGCACAGTCACGGGGAAGTATGCCGCTGGGAAGCTCGTGAGGAAGAGGCGG
AATGTGGGTTGGCACTGCTCCTCTGTTCGTTGCCCCATATCCTCCACCAACTTTTCAAGTTTCGGCATCCAAGACTTTGCGAGATGGCAATTCTGCAGCA
GCACCCAGTCACCACTGCCTTGACTACTCTCAATGAGTTTTTCGGCACGCGGACCTTGTCCTTGACCGAGCGAAATGAGGTGCAGCCGATCGATGAATGA
CATCTCCTTCGCGAAACGAAGCAGCATGCCTGTCGGGTCGGCGCCAGCAGATAGGACGAAGATACACGGCGTCTTGCGATCAGTGTCGTTGTAAATCTCC
TCCATAGTCGTGGACGCGTTTCTCCCGAACTCGGCTCCCATCTCAACGGAGATCATGTGCAGCACTGCCTGGGGCACCTTTTCCTCGGCCAAGCCTCGAA
GCAGCAGCACCTTCTGGAACGCGTTAAGTGTCGACCCGTAGCTACCCGGGCAAGATTTGGGATTCGACAGGAACTCGGAGTCTTCGAGCCATGCCAGCCA
ACGGGGCCAGACATTCGTCAATGAAGTGCACAGACCCTGAAAGCCGAGCACTTCTGTCTTTTCTTCCCCCTCTGGAGCTGCGGCGTTGCTGGTCGCCATC
GTCTCGAGCTCTGAGATCAGATCCCATTGTGCCTCCGTTATGTGCGTAGGCTGTGGATTCGGCTGCTGCGAGGAGCGATCGCTACCTGGTGGTGCTCCGC
GGAGGTAGAACGACCACTCCCGTGCCGATATTTTGCCTGAATGTAGCAAGATTTTGCAGCAGATGAGCATGGAGAATAACACCTTGTGCACCTCGAAGAG
CCCGCGGCAAATGTTCACGTAAATGTATCGCGTCTGGAAGTCGATGAGGTTCGTGAGTCTCTTTTGAAGTGTGTCGGCTTTCGGAGCCTCATCGAAGCAG
ATATTGAACAAGCGCTGGAAAAACGGCAGCGAGTACTGGTACATGGGGTCGATGAGAGCGAGATTGGCTACGACAAAGTAAATAATTGACCCGCGCGTAG
CCACACAGCGATACTCTTCTCGAGCACGATTGATCTCAATCTCCGTGTTTTCGGACTCCAGCACACGCTCCTTGATGGCCCGCGAGGTGACATTTGACGA
CTGCAGAGTATCGATGAGGTCCTGGTCATCCAGTACGTTACCGGAAGACTCAGAAAGCTGCTTCAGAATGCGGTCTTCGATCTCCTTCAACTGCTTCTTG
TCTTGCGCCATGGTCACAACGAGGCGGTTCTTCTTCTCCTCGATGTCTGGCCGTTCGTGGCGCACAACATCACCGAGAAGCTGGTCCTCCAGACCATCCA
TCGTGACCGTGAAGTTAATGACCGTCACCTTGATGTAGACCTCTGGCAGGTAGTGCGGGTTCGGAAGCTTTGTTGTAAGGAAAAGCTTGAACGCCGGGTC
GTAGTCCACGTCCGAGTCACCAAGACGGATCAGTACGCGCCCACCCTGTTTGTAAATGGCCTTCTGCAGGATCGGCTCGAGTGACGGCTCCAACGTCTCA
TCGATGTCTTCGATGAGCAGCGCTTTGCCATTGCGGATGCACGTCTCCAGCGATCGAAGCAGATTTGCGTTGGTCATTTTCGTGGCTTCGAGTTTCTGGG
CCAAGGTTTTCTTGATCCACTTGTTTGCTTGACCCTGTGGGTCAATCATCAATGGCCATCGCTCTCCTCTAGTGACGAGGATAGCGTTATCCGTCGACGT
CGAGTCTGTAGGCAGTCCATTTAATTGCCACTCGCGGATCTCCACGGGACTACCGAGCGTAGTTGACAAGCTGTATCCAGGCGAGCAAGGAATGGCAAGT
GCCTGCGTCTGAGTCACCCACTGGTCGACAATCCTTTGCCGGAACCCGCCAGTGAATGGACCGTAGTACGAGATACACGCTGCAGCAAGGAAGGTATCGC
CAATCAATGCCAAAACGGATTCGGCTAACGACGCCACGCTCTCTTTCCACCGAGCGCCTTCCACCGACAGCCCCGAGATGAGCTTTTCGGCGCGTACCAG
TCGCTTCTCCGTCACCGCAGCGTCGTTTGCCAGCTTATCCTTCTCGTCCAAAGTGTCTTTGCACTGCTTTTCCAGCATCGCCACGTTCTCATTGACCACA
CGGAGCTCCTCCTGCTTCTGGCTCAAAACTGCGTTGGCTTCAGCAAGCTTCTGGTTCATCCGCTCCAAGTTTTCTTTCTTGGGTCCCACCTCTTTCGCTA
CTTTTGAGTAAACATCCATGGCGTGCACCCACATACAGAGTGAGGTAGCGGCCTTGGACACCTTGGACACGATTTCAACGGCCATGCCTGGTTCCGAAAC
AGCTTTACTGAGTTTCTTGAGTGTGGCGGCGGGGATGTTGTCCTTGTCAAAGTTTTTCAACTTGTCCAGGAAGGCCACATCTCCTAGGATCTTCTTGGCT
GAATCCCAACTTTGCTTTTCATTGAAGAGCAGGCACACAGCATTCATGACCGTCTCCACTGCCTCGGGAGGCTTTGCAAATGACTTGACCTCAGTGATAT
CGTTCTTCGAGAGACTATCGAGGGCTTTGACTGCGTTGCTGAGCGCCGGCATGGCCACATCGAGGTCCTTTTGGGCATCGGCCTGCACTATCGACACCTC
CTCAGCCTGTTTGGTGACGGTCGCTTCATCCTGTGAGACTCGTTCCCGAACAACTGCTGCTGCCTTTTGATCAACAGATACGCGCTTCAGCAATTCCTCA
GCTTCTACCGCTTTCTTCTGTAAAATGGGCTGCAGCTCAATCAGCTCCGACTTCAACGTGTCCACGATCCCGTTGGTCTCCTCAAGCTTCTTGACGCCAA
CTTCCATTCGGTTCTTGATCGTCTGCAGCACCGCACGCTTCTCCTGCAACATTTTGAGATACAAACCGATAAGGTCCAAGTAGCTCTTTGGCGTCGTGTA
CACGTATCGCTGCAGCTGCGAGAGGAATTCGTCGCCGAAGTCGTTGGAAGTTGTATGCACAATTGAGCACATGTCCACAAGCGCCACACGGACGTCTTCT
GAGGGCAAGGACACGCCGGCAAGCAGTCGGTTAGCTACAGACTGCAATGCTTCACGGGGCCAGTTCATGTACCAGTCGATCGTGCAGCAATTGATGAGCG
ACGGGAAAGCGCGGCAGCGTACACGAAGCGCCGAACCCACGGGCGACATTGCCAGCACGATGTGTAGGTAATTGCGGACTCTCTCAATGAATGTGAGCAC
GCAGTTATCACGCGACTCGGGTATCTCCAAGGCCTTGACAATCGGACGCATGTCAGCAATGATGCGGTCCATTTCGTCCTGCGGGAACAGATTGGGCACT
TCGCCGCTGTTCAGAACGTTGTTGATGTCCTCTAAGAAGCTCTCTTCGACGATCTGGCTGTCCGTGAACAAGAACACAGTGGATTGGCCCCCTACACCAG
CGCTGATCATGAGCTTCTTCAGGTCTTCGTGGAACTCGTTGGTTCCGTAGCCGCGAGTGATTTCGATCTGTACACACCTGGCTTCCACCATGAAAGCCCC
GAGTCGAGCAAGCGACTGCTTGCCACTGCCGCCGACGCCAATAAGCATAGCGTTGCCTCGCGGTTGCCTGAGAATCCGAACCAGTCGGGACAAGTGCGCG
ATGGCATCACGGAAGAACACCAAGTTCATCTTGCTGGCGAAGGTCACATTGTAGTTCTCCAGGAAGTCGTCCATGATTTTAGTGATCTTGGACACGTCAT
TGCAGTGCTCGTATAGAGGCGTAACGCCGGGCTTGAAGAAGTCGCCGAATGTTAGCGGGCATGGAGAGTTGAAGAGAGTCTCTCGAGGCCAGCTGCAGTT
GAAAAAGCGCTGCAGCAACGAGCACACGAGCTCTTCAAACCACATTTGGTCAGGTACATTGATGAGTCGATCCTGAAAGACTCGCGAAGCCTCGTGCACC
CACAGACGGTTCATGGAGTCTGCGTCTGGACACTTGGACGGAGTGATCATGAGAATGCCCTGGAAAACCTTCGATACATCACGCAGATTGAACGTGTAGT
GGAATTTGTTCGGCGTCGGTAGCAGCTCGAGCGTCACTCGATTGTAGATCTCGATAACGCTCGAAATGATGCCATCCTTCATCGCTTTCACGGATGGGGC
AAACTTGTCCAAGAACCCTCCGAGGATCGAGGCGAAGATAAGCTTCAGAGACGTCTCACCTGCCGGATACATGCTCAAAACGTGGAAGTGACGCACAAAT
CGAGGCGTGCAGTGGGATCGACCTCCTCCGGCTGGAGCTGCAGCTGCGAGTAGCATTGTATCTGCAATATCTTTCCAGAAGAGTTTGTCGCGGTCGTAAA
ACCCACCGAAGTCGAGGAACTGCCGCAACAGTTCAATGGGAGCCTGAGCACCGTACTCCTCGACTGCTGGCAGGTTCACATCATCCACAAAAATGATCAT
TCGCTTGCCTGCTACGGGTCCTAGCAAGTTCTTGCGCTTTTTCTCCAGCTTGTTCTCGATCGTCATCTGCGTGACGAGCGATGACGTCTGCGCGGAGAAG
TTGATGAAGATGGTCATGAAGTTTGACGACGGAGCGGATGGAGCTTCTCCTCCTTCCCCGTTTGCTTCGCCACTTGCCACCATAGGCCCGGACTGAAGCT
CTTGCAGTAAATCTTGAACAATCACAGTCTTGCCAGTGCCGGTGATACCGGTCACATACGCTGGTCGCTTCGCTGCTGTCAAGGTGCGCAGCAAGAATGT
GAATCTCACCGAGTCTGGGGTGGCTACCGTCATCTTAAAGTAAGGCACTTGCGCGTTGTACTGGAACTTGGGTACGATCTCACTCCATGCACGGAACTTT
GCCTGCTCGATATCAACGAAGTAGTCAAACACGAGACCTGCATTCGGGATGTTAAGCTTTGCTTCGCCCATCAGCTCCCGGGAAAAACTATCAAATTGTT
CGTGCGTGTCGGCCGTCATAGTCGCGCCTACAGACCAGAAGAGTGAGAAGGCGAAGACTTTGTCGAGAAGTTCAAGCATTTCCTCCGTTTTCATCGACGA
GTAGGTCACACCACCCGACGGACTGAACAAGCACGCAAACAACCGACATAAACTCGTCGCGAGGTTCATGTCCACTGTCGGCACGAGTTCAAAACTCTTT
TTGCGGACAAACTGGATGCACTTGTCCATGTAACTTGTGATGAGGAACTCGAGCCGTTTGAGCCCGTCAGGCGGGAAATCTGATGGTAACTCCTTCTCCA
TCCACGTCTTCACGAACGGCATCCAACCGAGATCTGTTGCCGTCATGTACACGACACCGATACGACTCACAGTTGCAGGAGACGCCACAGCCAGATCCAT
GACTTCAAAAAGCATTTTCATCTCGTTCTTAAGCTTGATCCGCTCTCCGTTGGCAAGACACAGCGTCATGTTGTCATCAAGTACCGTGTTCATGTTCTCA
ATCCAGAGTGCATCGATCGGCCCGTCGAACACGGTCCATTTCACGTCCGAAGTCTCGTCCGCCACAGCTTCACGCATGATCGTGGAGGCCAGGCCGTCAT
GCCATTCTTGCGTTGCCTCATTAAACTCGCCGTAGAGCTCGCCCATGGAAATACACTTCGGGTTAAGCACCCGAGCAAACACAGTCTGGTAGACCGGATT
CTTTGAGCCTTTAGCTCGCAGCGAGGTCATGGTCGCTTGAAGTGTACGGTAGCAAGAGGTCTTTCCGGCACCAGTGGGGCCAACTAGCGTCCCCCCAAAG
CGCACATTGAAGATGTCGAAAAGCTGGATGACCTTCGTGATGTACGTAGGCACTTTCTGCAGCCCCGCCTTCGTGATCTCTTCTTCAAGAGATGCCTGGA
GCTCGCCATAATCGTTTGGAGGAATATCAGTACCAGGGAACAAGTCCAACACAATGGCGTGGAATAGTGGCAGGTCATCGGCCAAGAATTTGGGGATGTT
GCTATCTCGCAGAGCGCGAATCAGTGTCACATCCTCATTCAAGTCAGGGTTCGCACGCTTGAGCGAGCCAGCCATGACGAGCACCGACTTGACAGCACGA
AGGCCATAGTCATAGTGTGGCTGCTGTGAGAGCTGCTCGCTGCACAGGATGTACAGCTTGCACATTTTCCGTGACAATGTGCGGGCGTCGCCGAATCCCT
CGGCAAACAACATGATTTCTGCGATCAGCGCGTAGTCCGGCACCATCATGGACACAGGCCGGAAGCAGACCTTCAGGTTATCGGGAAGCTCTGTGCGACC
TGCGTATCCTGGATTCATTGTCACGATCACGTGGTGGTCTTTGAGTAGAATCTCGATGCCCATGAAGTTGATATGCTCCTTGCCTTGGATTCGACCTTCA
CGCAGAATCAGTAGCTGCTGAGCCACCACGGACAGCACTTCGATATCAATGCGGTTGAACTCATCCAAGCATGTCCAATTTCCTGCCTGCGCGAGTCCAC
GGAACAGCTTCCCCATCATTTTGTAGTCGATCTGATCACTGCAGTTGAACACAACGCACTGGATAGCCATGGCTTTGGCCAGATCTTTGCTGCTCTCCGT
TTTACCGGTTCCTGCTGGGCCAGCAGGGGCTGCACCAAGTTTCATTCCGTACGCTCCTGTTAGGGTCATCCAACAACGATCCGTCAAGGGTGTAATCACA
AGTCGCGACGTGGCCCCCATGTACTCGTAGCCGTACTGAATGACGGAATCAGAGTGCCGAATGAGCACGTCGTCGGCCTGTGCGTCCCAGTAGTAGCGCA
GTTGCTGCTGCCAGATAAAATTCCCGACCGAGTCCACTCTTTCAGTCCACAGACTCTCCACAATATCGCGTGCGTGCACGTCTGTAGTCACCAAAGCCAC
GATGACCTTGCGTTCTAGAGAACTGAGGTCTCCGCGAATCTTTACGATAAGTTCATTCAGCTCGTACAAGTTGCGTTTATACCAGGTGTGCATCTCTTCA
ACCGGTTTGCTGCTGGTGAGAGCTTCTTCGGTACTTCGAGCCCATGTCATTTGTGCCACAGTGGCCACGACTTGGCCAGGGTGATCGCACACCCACACCG
ATCGCTCTTTCGTATCGTAGTCTAGTAGTCCCGCCTTCATGAGTTTGTAGATCGACTGCTTCATACTAACTTCCAGTGCCTTCAACCAGTCCTCGACGTT
TCCTCGAGCTTTTAAGTTCTTGCCTAATGGCACACGCTCGTTTTCGGACGAGTACATCGCAATCATATCGACACTACCGGGGACATCTCCGAAGTCCAGT
TTCACCAGGTTCTCGAAGCACTTACGAAGGTGGGGCTGTACCGCTTGAGGGTTCTTCGACTGCGCCAAAATTTCCAGCAACTCGTCGTTCGACAAGAAGT
AAAACCGGGGAAATGCCATACGCTTCGTCTCGAGATAGTCCTCCAAGTTCTTCTGGATCTTGTCAAGGTGGGCGTTATGCTGCTGCAAAGTCTCCTTGAT
TCCCGGGAAGGTCCCTGACGTCAACACGTGTGGGCTCTCGTTGGTTCGGCGCATGATAGTTTTCCAAGATGCGTCAACGTGACTGAAGATCTTGGACGCA
TCCGGCAATTGACGCTGGATGTCGGGGGCCGAGAAGATGTTCTCCAAGTACATCCAGTTCTTCTGCACTAGCAGCCACTCGTCAAGTGTTTCCTGTAGCG
TCACCAGTTTCTTCCTCCAGCCTTCCACTTCCTCTTGAATTGCGCCGATAAACCGTGAGCCCATAATTGTACTGATTGTCACGATCGAGTCGTCCAGCTT
CGCAGTGACATCCTCTACGCTTCCTAGTACAAACACGTCCTTCGATTC