Description :
From Genome Similarity Track
Location :
contig_76:159777- 161457
Transcript NameFunction/comments
g12448.t1XP_009514087.1 hypothetical protein PHYSODRAFT_320696 [Phytophthora sojae
g12449.t1RAW40523.1 hypothetical protein PC110_g3298 [Phytophthora cactorum

Sequence
1680 bases(100 bases per row)
TTCACGTAAGGAAGTCGATTCGCTACTGAGGAATTGGCGAAGGTTTTGGCTGTAGGGGTAGAATTGTGGCCATCCGTTTCTATTGTGATATTTAATGGCA
AAATCAGGTTAGTGGACACCATTTTCACAGTAGCCTTTTGTGCAATAATGAACGAGTTGCAGCGCGTGCTGGACGCGTATCGCGGCATGGAGCCCGTGCG
CGACCTCGTTGCCAGGATCAAGACGCAGTTTGCGGACGAGCAGCGCTGGGCGACGCTGGAATTCCAGGTGGGCAGCGGTATTTTTGACATTGGAAATGGT
GGCACAACTCACGTGTCAATCATTGGCTGCAGGCTCAGGTGATGCACGTGGTGGTGAACGACCCCGTGTGCGACGACTTCCCACCGCAGCGGAAGTACAC
GTACAGGTTCCTCAAGCGCTACTTGGACGGTATGCATCAGACAAAACATTTTTCACATTTTGGTGAACTATCGGAGACGGTCGCCATTTTCGAGTGACCA
TTGTTGGTCTCTACCGTTGCAAGGTCTGATCAATGTTGTTGCCGTGCATTTTTGTCGACAGAGATTGAGGCGGTGCAGGCGGATGCCGATGACGGACTCG
TCGAGGCACTCATGGAATTTGTACTGAACGCCAAGCTGGCCGATGACTCGCTCAATGCTGAGGCAATGCACCACGTTTCGTACACGGTGCCGACTACCGA
CTCGTCCGTTGTCGTGTCCTGCCGAGTAGCGTCCGTGTTCAACGAGGTCGGGCTCAAGCTCTGGGAAGCAGGATGGCTGCTCGCGGAGTACATCATCGCC
CACGAAAGCGAGTTCCGCGACAGGACAGTGCTCGAACTAGGAGCGGGTGTAGGCTTTACCGGGATGGTTCTGGCCTGCGTGTGTCGCTCAGACCGCATTG
TGCTCACGGACTACGCGCCCAACGTCATGCAGAACCTGCGTTACAATGTAGAGATCAACGCCAGCAAGTTTCTGTGCCCGGTCGAGGTGCAGACGCTAGA
CTGGGAGACATGGCAACCCGAAGACCACGACGACGAGCGGCCCGACGTGCTACTTGCAGGAGACTGTGCTACGACGTTGCGGTATTTCCTGCTCTGATGC
GCGTCCTTCAGTCGTTCCTCGGCAACGACGGAGGCAGCACAACCCAGCACCCTCAGCGCGTAGCAATTTTCGCGGCCACCATTCGCAACCAGAAAACATT
CCAGACATTCCTCGACCAGCTAGCACAAAACCGCATTGACTACGTCGATATCACGGCTTCCTCGGGTGGACAGGTCTTCTCGTACCCGAACCGAGAGCAG
ATTCGCATTTGTCGCCTCTCGAGATCCATTCTCGACGAGGACGCACCTGCAGAAACGAAATAGTTTTTGTTTGTCGTATATTTCGTGTTACATGGAGTGC
ATCTTGACCCTGAAGAAGAACACGCAGACGATGAACGCTAGCAAGCTGACAGCGCCGCCTACGAAGACAGGTAATCTGTAGCCCATTGACGTCTCCACCA
GCGCAGAACCGACGATGAAGTTGAGCAACTGACCAGAAGAGTTGGCGGAGTTCATGACGCCTACGTACACGCCGATGTCGGCGGTGTGGCCGAACACGTG
CACAATGAGTGGCACAACCAGTGCGAAGAACGTAGCGATTGTGATCGATGAGAGAGCCACGACGATCAAGTCCACGGCCA