Description :
From Genome Similarity Track
Location :
Scaffold_67:15977- 17467
Sequence
1490 bases(100 bases per row)
TTACAAACATCGCTCTCTGTTCCGGTACTTGTATAAATTAATACCCTGAGCAAAACGATGCAATTATTTTAAGGAGGGAGTTTCTGGCGGGAATCGCTTA
GCTCCAGTCATTCTAAAGAGCAGCACCGTGTTAATATCCAACACTGCGTAATATACATCGGTCCATACCCATGGGAGCCTGGATCAAGATTAAACAGAAG
CGCGGTCTCATCCAGAAGGCGAGCGACTGCCCCGGCATGACGCAAGAAGTGCTGGCGGCATGGGCAAAAGCGACGTTCAAGCTGAAGCGAGCGCCGGCGC
AAACTACTGTTTCTGATATCCTTAACGGCGCCTCCAAGATAATGAACAGCAGCTACGGTGATGGTGTGAGGCGGAAACCTCTACGTGATACCTCGCCTGT
TCTGGAGAAGCTCTTAATAGAGTGAATTCTAAAACTAGAAGGTAGTGGTATATGTCCCTCACGAGACTTAATTAGGCTTAAACCTCGTGAGATTCAGAAG
AACCTACCTGGCGCATGGGATATGAATTTTTCGGACGGATGGCTAACCACGTTCGAGCGGAGGCATATCTTGCGATTCCGGAAACTTCCTGGTGAAGCTG
GTTCTGCTGATCATGTTGAAGTTGACTTTGGCCGACAGCGACTACAAGATGTAACCAATCTTTATGAGCCTAAAGATATCTACAACTTGGATGAAACGGG
ACTCTGCTAAGCTATGGCTCCGTCCCGCTCCATTTGCACGAGGGGAGCCCGTGGTGCCAAGAAAAATAAGACTCGGATCACACTCGCTCTCATGGCGAAT
GCGGATGGGACTGACGCGTTACCGGTGCTATTTCTGGGGAATGCAAAGAATCCACGCTGCTACAAGAAACGTACGGCTGATGAACTGGAATTTAGTTATC
GCTCTAATAAAAAAGCATGGATGACGGGCGTTATTTTTAAGGAATGGCTGATTAATCTTGATAGGGATATGCGTGCGTGTGACGCCATATTCTCTTGCAG
CTTGACAACGCTTCTTCATACAAGCTGGGGGATCTTATATGTACCAATATCCGTGTGGAGTTTCTTCCTCCCCAACACTACTGCGTTCCTACAACCTATG
GATGCTGGCATCATTGCATCATTTAAAGTGGAGTACCGAAAGAAGCAGTTGCGGTGGTTTTTCGACAGATCAAGATCAGTGTTGAGGTTGAAAGGAAGGC
ATGCTGTGGATCAGCTGCAGGCAATACAATGGAGGAAGGGGATCTGGCAAGATTTACAAGGTAAGCGTACAATCGAGAACTGTTTTCGCCAAACAGGCAT
TAGTTTTAATGCCGTAAATGAGAGAAGTAAATCAACCGAGCAATCCAGCTACGGACCCGATGTAGACTTAGAAGCTGTCATTATCCTAGCCTCACAGCTG
AGCCTGAAACTTTTACTTTAAAATAATATATCAAATCCAAGGAGATGGTCGGACCACAATACCGGAAGTGAAAGCGATATTTGTATCTGA