Description :
From Genome Similarity Track
Location :
scaffold_38:159748- 184715
Transcript NameFunction/comments
g12686.t1hypothetical protein
g12687.t1 tyrosine aminotransferase, putative
g12688.t1 glycoside hydrolase, putative
g12689.t1 hypothetical protein PHYSODRAFT_551993
g12690.t1hypothetical protein

Sequence
24967 bases(100 bases per row)
ATCACTGCACTGCTCGACGGCTTCATCACCGCAGCCGACCGCTTCGTCACTGCGCCCATCTGTCGCCTCACTACTGCATTGCCTGATGGCTCCACCTTCC
GCCTCACTGCTACGCTTCCTGACGACCCCACGTGCCGGGCATCTGCAGACGACAGCAAACACCGCTCTGGCGCTGATCCACCGAAAAAGCAGCGCGGAAA
GTCCTTGACGAACTTACCATACGTCCGCTTGAGAGATGCGAGGCGCAGCCGAAGCTCGGCAGCTGTCCGCTTAGACTTGGTCATGCGACGCACCACGTAA
GCCCATGTGATCCGAATGCCTTCCTTCTCAAACTCGTAGGCAATCTGAACAAGTTGTTTGTCTTCCCAATCGAGAAAGCTGGTGCGCATGGCTGAGGTAG
TGCGTGTGTCTTAATTTAACTATAGCTCCACTGCAACTGAATGATGCATGTGTATAGCTGTTTGTAAGGCCACACAGTGACTGGCGCTGAGGGGAGGGTT
GATTCGGTAAGATAAAAAAAATGATGGGGATCCTCAGTTTATGAACGCAAATGGGTGACGTCGCACGTATTTTAAAGAGCCAGACCAAGGCATGCGCTTG
CACCCTCTGCTGTGATTGGTAGTAACAAAATACGTGAGTACGTCAGGCCTCAAAAAGCTAAAAGGGCACAAAATGCGCCCCTGGACACGTCTCATTCGCA
CCATGTTTTGCAAAAACCCTTAAAGGGCGAAAAAAGTATCCTTTTAGCGCGAAAGGGTTAAACAGCAGCCAAAACATTATTTGGGCACTACCACGATGCA
CTCATCGCCTAGCCCTAAGTGCTCCCCGTCGTATTTTATCACTAAGTTCGTTTTGTATACAGCAAAATCGGAAAAATCGGCAAAAATTCGACATCGTCTA
CCGCCACCACCTGGAGGGTGGCAATAGTTACGTACCTGTAAACTATTGCCACCCGGGGCAAAAATTCCTGCAAGTCTATTGACACCGACTCGAGGTTGGC
CGTTAAAATTTATTGACCGACTTCGTTTGGCTTACCGGTATTACGGTGCCCCACATGGTACCGCGTACCACCGATAAAACCCATAAAAAATACACGATTA
CCGTAGTTTTACTCATAACGCACGATATTTACTGGTTCATCATTGTACCGTTCATGAAGCTGTGTGTCTGTTCTGGCTCAATCATGTACACGTATTGGTC
TTGCCTTCTCCCTCACGGATCACTCGCACGCCGTTTGCCGCACGCTGCTCATGATGTATCCAAATGAATGGCGAGTACACAACGTAATATAACCGTTATA
TTACTGACCATTATAAACAGAGGCCAGCTGAAAAACCACAATGAGATATGATTGGATGACCGTTATAAGCAGGTATTCGTAATAAGCCAAGGAAGTCGGT
AACCCCAGATTCAACATTTGAATGTCGGCTGAAGTGTAGTGCACTTGCGAGGGGAGCTATCCCTGTTGCCCAGTCCAGACATGGGATGGTCTGTCCGTGC
GGCTCTCTCAAGTCTAACCATTGTTGTCTAACTAAGCATTGCTGGGCGCACGCATTGTCCTGCAGCCTGTACGCGCTTCAATATTGTTCTCATGAACACA
GCCAATTCGAAGGTGTTCTCGAAAGGTGTTGTTGGGTACGCCCGAGGCTTCGCAAGCCCTCACTTTTCACTTCGTTCCGTCAAACGCACTCGTCCAGTCT
CCAAGCTCCAGCGTCGCGCAAGTGCCATCCTCCGCGGGAGGTGAGGAGGAGGGCGAGGAGGAGGAAGTAAAAGATCGCTGAAGGAGTCCCGACAGCCAAT
CCAAAAATGCTATTCTTTGCGGAACTCCCAGCGCGGACGTGAGGCTCGAGGAGAATGCTCCGTCGACTCGAGAGCTGCGCAACGGATGTCACGTCATGTG
ACCTGAACGACGGGACTGAGCACCGTCCAAGTTTGCTTCAAACAAGACATAGCAGAGTGTCGCCGTGTGCCTATCTGGAGGTGGGGAGGGTTTGCATGGC
GATAGCCGGCTCGGGCATGAGCCCTTTCGGGCTCTGTAGGCTACGTAGGTACCTATAGGACGCTCTTCAGGGATAATGGGTTAATTATCCATCTGGAACT
GTTAACCACGGGGCTGACGCTTCATTCCGCCTGAAAGCATGGTCCTCTCGATCATAACTTCTCCATTGGAGAACGATATCGTCGAATCTTCAGTGCTTCG
AATAACCTGCACCGTGACACGGTGCCAGACACATAGCGGCTGTGCCTTGACTGAAATGCAGCAGAAGATTTCCGTTCCTGGCGGGTTTTGTACGTCACGA
GGGTGCAGTGTACAGCAGGACCTGTCTTCTGGTCCGAGGGTTCCCTGGGTTTCAGTTCGGTTGCATTGAAGTTACTGTGTCAAAGCGATGTTGCAGCAAT
CGACTTGGATATTGCTGACCTCGCCGAGCTATCCTACACGACGTCCGTCTCGCCCGCGGCCACTATCCTATATATATAATACCGAGGTTGATACTTGCTG
CGAGGAACGTGTGTGGGATCGGTTTTCTCGTGGGTTGCCTCGGCAGCGAGCGCTTCTCCATCCATCGTCGTGGAAGACCGCTCTCTGGAGGTCGAGACAT
GGTGTGACCCCCCCAGCTGGCTGCGTTGAGACTTGCCCCAAGTCTCGATTGCAGGTGGAAATCTCTCTGCCGCATTGACCAAAATATCCTCATTCTTCAA
TTCACTTCGAAACCGGCAGTAACGACTGTGGGTGCGGTTGTCGAGACCGGTTGGTAGCTGCACATGTTTTCCTTTTGACAGTCACAGGCCACGTCCTGCC
GTGTGCAACACGCCATTCTCACTGTGATACTTGTTGCTTTCTCTCGCTTGCTCGGTCGTTCCCATCTGTCTGCCTGCTCAGAAGAAATCTCGCTCTTCGA
CGGAGAGAAGACACGAACATTGACCCATTGGCAGGTAGCGGAGTGCGGCATCTGGTGGATTTCCCTCGATCAAGTGAAGTAAGGAGGCAGAGAGAAACAG
CGATATAAGAAGGGGGGAGGCCATGCCGGTTCAAGTGCGAAACAAGTTGCCTGGCAGAGAGCACCTGCCGGAGAAACCCATGCACCAAGACTTCCCCGTG
TTGTCCTGCAGCCTGGCAGTGAAGCCTGTCAAACGTAAACCGCTCGTGAAAAGCCGATTGGCAATGGTGGCCAACAGCGAGCGCGTCAAGAAGCCGCGCC
GCCTTCCCGGCGATGAGACCGTCTTCTACAGCAATATATGGTCGCCACCCGAGTCCACGCGGGACGTGCGTGTTTCCAAGAAGACGACGCAGCTCGTGGA
CATCAGCCAGGTAGCGCACGTACTCACGACTATTGACTACAAGAGTGGCTACGAAGTCCCATCCGACACGGCGTTTTTCAATATCTGGGCGTCCATCGAA
TCGATACAGAATACCAAAAACGCCGCCATGATGAGCAAGACGCAGCAGAGCGCCAGTAATATGTCGACGCCCATTTCCGAACACAGCAGCGAGGAATGTT
CATCGGTGGTCACGTCGTCTAGTCAGTTGAGTCTCGGGCCACTGAGAATGGATGCGAGCGCGCTTCGACGAGAGCTTTCAGGAGACGATTTTACCATGGT
GATGAGTGCTCCCGTGTCCGCCCCGCAGCGCAAGGGCGAGAATGTAGTGTTTTCGACAGTGTTAACGCACAAGGATGAAGTCGACATGAGCTGGAATTCG
CAGTTCCTGCTGGGACTGCATGAACCAGTTCGGCACGCGCTTTTCGTAATCGATCGCTTCTTGGAGCGCAGCCGGAGCTTGAAGTCGCCCATGAACTGGA
ACGTGGGCGCGTTTTTCATTTGGTTCAAGATGCACTTCGTCGAGTTTGTCCGAAACCAGCACGACGTGAAAACAAAGGTGCTGCTTCCGCACGTGGTTAT
CAAGTTTGTGGAGAAGCGTGATATCGTTGCCCTGTACCAAGCTATTTTCACATTGGTGGATGTGATCGTTGAGCAGGAGGACGGATTGCTGCTATCAGCA
GTCTCGTCAGCGGATTCATGGCAAGCTCGTTTGGGTCTACTTCAGGACGATATCCGACGTCTCAACCACCTGCTTTTCAACGTGCTGGCGCTAGAAGAAG
AAGCCTTCAAGCCCGCTATCGAGCTCGCATTTTCAGAAAAGGCTTTCCAGCGGTATGTGATGCCGCGTATCTTTCGCGCGACCAAACCCAAGCGCGTTAT
GGTACCATGGATTGTGGAGCGAAGTCGCGTCTGGGGTGGCACCAAGGTCGCTAAAGCGTATAAGGACGACCTGTCATTCACTGCGCGGTTCCTATATGAC
CACGTGTGGCACCCGTACTTTGAAGCGAATATTGCATCTGCCATGAAACACTTGGGCAACGAAGTCGAAGGTATGGCTGCCAACGGTTTGGATGAGTCGT
GGTTTGGATGCTCGGTCATGTAGTGAGTGACCATTAACACCGCAGGTGTGCATCCGAGAGATCATGACAATATCGGAGCAGTGCTGCTTCCAGCAATCGA
CACCAACAGAAGGACCGAACGTTCTCGTTTAGTATTTAAAAGGGAGCCCCAAATAAATTGTCGTTCCCTCTCGTTCGCGTTTGATCGGTCAATAGTTTTC
TTGCCGAGTTGCTGAGGATAACCAACCGCAAAATAGATCAAACGATGGAATTGAGGAACTCCAACACGCGCTTTGCGACCAGGAGCTGCCTCGTTCTAAG
CTTGATATCTTCCGTGCATTTGCTTTCCCCTTGCGAGCCGCGGCTTCTGCTCTCTTAGCTGCCGCAATTCCTTTTCTAGCACAGTCACGTTATCCTGATT
GGGACTGTTGATCGCCTTGAGCAACGCGGAACACACCGCGACATTCGCCGCATATGCTGTAGTTGTCGAGAGTACAATCTTCCTCTAGCTCGCAGCCCAA
CGGTTTGAGTTGCTGTTGGCTTTGCAACGCTGAGCACGGCCTCGTGGAAGCTAACGTCTCCGGGTTGCGATGTTTCCGAGCGCTTAGCCATCATCCACAG
CAGCGTAATGCATTTCAGGTCGTAGTCGATGGCGATGGCGACTGACGCCGACTTGGACCCACCTGCACTACACGTAGTGTGCAACTCGCTCGTATCCGAA
ACGGAGCATCCAGTGGCGAGCGCCCGAGTCCTCCAAGCGCAGCCATTGCGGGCTACGCAAGCGTTGGCACGTCTTGCAGTGACATCCATGACTGCAACGT
CAACTGTCGAACATATTGGGCACTGTCGGTGTCGAATCGAACATATTGGGCACGTCGGTGTCCCGCGCAGTGCCAGCCATGCTTCAACTTGGTGTGCATT
CCACACTACTCGATGTGCGGTACACAAATCTTAAATCTGCGACAAGGTTCACACCATCCATCCCAAAACCTGCGCGTAACGAGTGCTTGGCGCAATGAGC
GAGGTGGCCGAGAATCCGCCAACCAAGCAGGAAGGAACAGCGCTGCAGCCTCCCACGGACGCGCAAGGACATCCTGTGCGCGAGTGGATTGACACGCTGC
TGCAGGCGGCCGGAATCGCCAAGGACAAGCAAAAAACGCCTGCGCAGAGCGACGACAAGGCCGCGGTCAATCCAACAGACGCTACGGCTGCACCCGACGA
CGCTAGTGTATCTACTACTGTTGCAGATGCAAAGGATGCTGCTGCAACTGATGCGACAACGAGTGAATCGAATAAAGAGGACGAAGACAAGGAGTCGTCA
CCGACGGTCTCCGATACAAAGGACGTTTCAATGGACCCTGCTGCCGATGAAGCAAAGCCCGGGGAAGGAGCTTCTGCTCCAGCGCCGAAGCGATACCGCC
GCCGGAGATGTGAAATAGAAGGTTGCTCCAAGTTCGCGCGCTTTAACAACGCCTGCTCGGGGCATGGCGGGCGGCGTCTGTGCGCGGAGGCAGGCTGCGA
GCGCGTAGCGCAGTTTGGCCACAAGTGCAGTGCACACGGTGGCATCAAGTTTTGCAGCGTCGAGGGTTGCCAACGTGCCGTGCAGTCTCGTGGCTGCTGC
AAGACCCACGGCGGAGGTGTGCGGTGCCAGTATCCCGACTGCACGAAGGGCGCCATATCCAAGGGCTTCTGTCGATCGCACGGTGGTGGCTCGCGCTGTG
CCGAGGAAGGCTGCGAGAAGTGGGCCCAGCGCCACGGATACTGCGTGCGCCACTCGAAGTCATCGTCTGCTCCGAAGGCGACGCCTATCCAACGAGCACG
GGAACCCTCTGGTGACTCGACCGTTCCATCGCCAGAACCACTACCGAATAGCGCTTCGACTTAGCATCCTATCCATAGCACAGCAGGAAAGCGTCGCAAT
ATGAAATTGAGAAAACATCATGCTGTGTGCACCACACAATGTTTGGCATCACAATGGCGCGCGACCCGGTCTGCTACGCTGGCTTCGCAGTGCAATGCAT
GGCACCAAATCAATTGCCAAGGTTCGCTCCAGAGTCCGTTCACTTGCTGGAATCCTACGCGGCACATCGAGATACTGGTGAGAGAAATGCGATCTTTGGG
TGCTGGTTGCAATGCCAGGAGCTCTAACACAACGTGTGCAATGAATTAGTGGTGGATATCGCGTGCAAAGAGCGATCGAGTGACTGCTACTCCGGCAATG
AGAAGGCCAGACAAAGTGTAGACCTGAAGTTTGGCGACTTCGTGGACTACTACCAAGCGACGTTCAGGAAGCAGTCGCATTGGCTGCAGACGGTGGGTGG
CCTGGAGTTTTATTTGGCGCAGTGCCCCATTGCAGTGCCCAAGCCCGATGCTACGTGCACCAAGGCAAGTCTGCCAGCCATAATGAACCATTTCCGCATG
TAAGGTGGTTATTCTTGTCATCTCTTGAGCCTGCAACTCTGACGGGCTTGTTTGTGGGCTTGCTACTGCAGACCGGCATGCCTTCAAGGCAAGTCTGTCA
CCCAAGTGAACCTGTGGATGACCGTGCAACCTGGCCGGACGACGCTGCACTACGACGCGTACCAAAACATCCTAGTGGTGTTGTATGGGAAGAAGGTTGT
CACGCTGTATCCTCCGTCAGACACCGCTAAGATGTACCCGTACCCAGTGCATACCAAGTCTACAAATCACAGCCAAGTGAACATTGTTCAGCCCGACTTC
GCAAAACACCCACGCTTCAAGGAGGCGTCGGCGCAGCGCTTTGAAGTCGCTGCTGGAGGTATTGCTGATTGTATTTATGAGCGGTTTACATCCTATCCTT
TTTGTTCAGCCGTTGATAACAACTAAGGCGTTGTTAACTGTCCTCTGCAGATGCCGTTTTGATCCCGGAGGGGTGGTGGCACCAGGTGGACTCGGACGAG
TTTACCGTTGCCGTCAATTACTGGTGGAATGGCGTGCGAGATCAGCTCGTAGAAGACCCACGCATGGCGCCGTATTACGGCCGGGTTATGCTGGAGGAGC
TAGTGAAGCAGCAGTGCGAGTCGCGTCTGTCAGCCGTGCGGTCTTCAGCGGCAGCAGGTACCCAGAGTACATTCCAAGACGAAAGAAGAGTGGTGGCAGC
TATTGTTGCAGCAAACTCTCAGGAAACTCGCGAGAGGATTTTTCTATCGCTGGACGCCACCACCTTCGTAAAAACTCAGCGACTCCTGGCAACGGATCAT
GCCCCATGCTGGCGGGAACTGCTTGCGAATGCTAGCGTGGACTTGGTGATGGTCTTGGCCGACTGCTGGGAGAGCGATGACTTTGAGGTGGATCTCCTTG
GTGTGCTGTTTGGTGCTTTAGAAAGCGAGGAAGATGCGGTCAAGGAACAACTTGTGGCCAAGCAAGCGCAGTTCCGCCGAGAATGCGCTGTCGAAATGTA
CCAGTCGCTATTTGGCTGAGCTTCAAGCACCTGTTCAACGTGAAGCCGTTACCCTAGGTTGAACTCGGGGCAGTCGACCAGCGAAAAGCAACTTGTTGAG
CGGCGGCAATTGGCTGAAATTAGTCCAAATGACGTCGGTGCCCGTCAGCGCGGGTAGATAGGGCAGAGATTGCCTTTTGCGTCTCTGAGACGCCGTCTCA
ACAACAAGATTAGCCTGAACTGGGATGGCTCAACCAGACTCTCATTTCTTAATTGACCGCTCAACTCAAGTGTCTTCTGTCGTCATGACCAAGCGTGCCA
CCTTCGACGATCCTGCCTTTGACGTGCCGATGGTAGATGTCAAGCGTCAAGCCAAGCTCCAGTGGAATGTCCAGCCGTCCGACTTCTCCAAGCTGTGCTC
CAACCCTATTCGGAAAATCGTGGACAACATCAAGAAGCCCGCGACGTCGACCAAGACCCTCATTCCATTGTCGCTAGGTGAGTGACCCTGTAGTTTTGCG
GGTAGTATTTATTTTTCAGAGCTAATCGGGAAACATTCGGCCGTGGCAGGTGACCCCACGGTGTTCGGCAATCTGCACTGCCCCGATGTGCTCGTCCAGG
CGATCGTACGAAACACCCGGTTCGTTGAAAGCATGACTTTCTGTCTAGCCGTTCTCGGCGCTGACCTTACTGTTTCTCTTGTTGCTTCATCAGTTCGATG
CAGCACAATGGCTACATTCATTCTGCTGGCTCCGAGGCAGCTCGCGCAGCAATTGCCCAGCACTATGGCAATATGAGAGCTCCGTTGACTATGGATGACA
TTATTATCGCCAGTGGTTGCTCGGGGGCTATCGAGATTGCTCTGCGAGGTTTGCTGAACCCTGGTGACAACATCCTTCTCCCGAAGCCAGGATTCCCGTT
GTACCAGGCTCTCTGTGAAGCGCAGAAGATAGAGTGTCGGTTCTACAACTTGAAGGTGAGCTGCTCTGTCAACTACTACGTAGTAGTATACAACGTTCCC
TGTTTGCTAGACTAACGAATTATGCGATCAATGCTTGGACAGCCGGAGAGCAACTGGGAGGTCGATCTTGAGCATCTCTCGACTCTGGTGGATGATAACA
CCAAGGCCATCCTGGTGAACAACCCTTCCAATCCGTGCGGCAGTGTGTACTCGAAGGTGGGTAGTGGTGATGGTTTATTGGCGCCATTTCGTGGCCGTCG
CGATTTTGTTTTCAAGTGTCGTAGAGGGCTTCAATCTCTAACGTTCTGCATTTGCCGTGTCGTATAGCCCCACCTGGAAAAAATTCTTGCTCTTGCGGAG
CTGAACAAGATCCCCATCATCGCGGTATGCTCGTTCCTCCATATTTCCTATTGCATTCGTGAGTCTGACTCATTCCAATTGGCAGGATGAAATCTACGGC
GACATGGTGTTTGGCAGCAACGTATTTTTCCCCATCGCAACTTTGACGAAGACGGTGCCGGTCGTGGCCGTGGGCGGTTTGGCCAAGCAGTTCCTTATCC
CCGGCTGGAGGGTTGGTTGGGTCATGGTGCATGACCGCAACAACGTCCTGAGCGACGTGCGCACCGCCTACTTCAAGCTGTCGCAAAATATCCTTGGTGC
AACCTCGCTGGTCCAGGTAACAAAACGACATTCGTCGCATCTCATGGCTGCTTGAACGACAGCTAATATGTCCACGTCGTTTGCCTGTGCTGTCTACAGA
GTACCATCCCTGATCTGCTGACCCCCATTCCCGGTAGTGCCGAGGAGCAGTCTCTCATGGACTTTAAACAGCGGTACTTTTCGACGCTGGAGGCTAATGC
CAAATTCACGACCGACACCCTAAGGAAGATCCCGGGCCTGGAAGTGGTGATCCCGCAGGGCGCGATGTACGCGATGGTACGCAATATCCGCAACCGACTG
CCCACCAATATCCTAACTGGCACCTATGCTCTGTCGTCTACAGGTGAAAGTTCAAACGGACGTGCTGACCAAGATCAAGGACGACTTTGACCTAACGCAA
AAGCTGCTGGACGAAGAGTCCGTTTTCGTGTTGCCCGGACAGGTGCCGTCCCAACATCCTAATTGTAGTTGCTGGATCCTTGGCTTGGCTAACCTGTGCC
TTCACTATCGTGCTGCCGAAAGTGCTTCGGACTGACAAACTACTTCCGCATCGTGTATTCGGCGCCGCACGAGGTGCTCGCGGACGCCTACACGCGCCTC
GCCGACTTCTGCTGCCGCCACCAGTAGCCTGAATTTACTTTATAATAGGGTTGAATCAGGCAAACAGTATGATGTTTATTTTCGTCCAATCGGCGTTCTT
GGCAAATCGCACGTAATTTCCCAATACTGATAACCTTTATGGACACATACTTTATTGTACATTGAATAGGACGGGTAGAGAGAGGGGCTAGTAGGTCTAC
ACTCTCAAAATAGATTCTGTATCATAGCCACAGTCCCTCTGTATTGTTATGGGTGCACCATCTGAAAATTCTCTGTTCGGAGGGAAAGACTGTCCGCGAC
TAAACTGAATTTGCTCGCTGCCCGGGGGGACGCCATGACTGGACGGAGCTTCCTGCTGCTGGCCGTGCTGGCCTTCGCCACGCTGCAGCACCTGACGGCA
GCCGCGGCCGTCGACGGTGTCATCGTTGTGCGCGGCAACAAGATGTACAATGCCAAGACGGGCGAGCGCTTCTTCATCAAAGGGGTGCGTTCGAACGGCA
CGAAAAGAGGATAGGAAGGAAGCGGCCAACTAACACCAAAGAGCACAGTTCAGCATAGTAAATCCTAGTCTAATATGTGTGTGATCCTGTAGATGACGTA
CGAGTACGCCGTGAGCGATGAATACTACGACAAGTATTCGAAGGCTGCGATCTCGGAGCACCTCTCGGGGCTCAAGTACAACACGTTGCGCCTGTACAAC
ATCAACCCGTCGTCCTCGTACAAGGAATTCATGAACGACATGGCCGCGCTCGGCGTGTACGTGATGGTTTCTGCCTCGCCCGATAACGACGCCTACTACG
GCAAGTACCGTTACTCGACCATCACCAAGGGTCTCAGCTGCTCCGGCAAGGTCTCGTCTGGAGATGGCGCTAAGACGGTGGATCAAACGGAGACCTGCTA
CCCAGCGCTGCTGCTTGAGTACGGCAAGAAGATTATCCAGAATTTTGCGCAGTACGACAACACTCTCGGTGTCGTCGTGGCCAACGAAATCATGCAGGCG
GACCTGACGGCCGGCTCCTGTGTGAAGGCCTACGTGGCGGATCTGAAGAACTGGATGACGGTGAACGGCAAGAAGATTCGTATCCTGCCGCTTGCCTACG
CCGCTGCTGACAGTAGCAACGATGAGGTCTCGAACGCGGACGACTACCATGTGATCAAAATCCAGGGACTGCTCTGTGGAGACAAGATGACGAAGGGTAT
GATGACGGAGAGTATTGATATCTACCTGATTAACGAGTACCGTTGGTGCCCGGACTCAACCTTCGCGGAGGCGTATCAGCGTTACATCGACATGGCGCAA
GGCATTCCCATCGTTGTCGCCTTCGGCGAATACGGCTGCAAGACTTCTTCGGCAGCGGCTCGCGACTGGGGAATGATTCCTTATCTGTACCAAGAGCCTT
CTAAGACGAAGGAGTTCACGGCGGTTTGGTCCGGTGGGCTGGCGTACTCGTATGGTGAAGCCAAGCTTTCGTCTGACTCGCTGTTCCCGATGTTCACTGG
TACAGCTCAGCTAGTTCATTCTTGTATACTATAGCGCACGGTGGGCTCATGTTGTGTCTGCATGTTTAGGTGGCAGCACGGACTTTTTGAGTACTCCCAG
CTCCAAGTCCACGACAGATTACACGAATCTGAAGGCCATGTTTGCCAAATACTCAGGCTATACGGATGATGCAGCATGGACCGACAGCACGAAGTGCACG
TGGGCTCCTACCCTTGAAACCAAGACGCAGTCGACCAACGAGCAGGCAACGAAGTACGGCTGGGTTGTAAGCAGCTGCTCTTCAGATCACATTAAGATCT
CTAGCTCAGACTCATGGACTTGCTCCAGTCGTGAAGGCGTGGTCTGCACGGACAGCGGTGCTACATGTGACGTGAAGCTGAGCTCTGCTGTCGGAACGAC
CCAGGAGGACATTTGCGGCACGTACGAGGTTACGAGCGGTGGTGGCACTTGCGAGAGCACGTCCGACTGCGGCGGCAACGGCCAGTGCAAGGAGTCGAAC
GGTACCAAGTCGTGCAGCTGTCTGTCGTGCTACACTGGCACCGACTGCAGCGTCAAGGATATTTCCTCGTGCGCGACGCTCAGCAGCTCGGACACGGCCC
CCCAAACCATTTTCGTGGGCGTTGGCGTGTTCTTGGGTGTCATGGCGGTTGTCTTCATCGCCCTCGGTGTCGCAGCGGCTAAGAAGAAAGCTGGTACGTG
CCTTGTCGGAAGCCCATGCTAATATCCTATCGTCAAACTAATTGTGCTCTTGCATTCACAGAAACGGACAGATTGGCACAGGCGGTGAAGGCTGGCGGCA
CCAACCAAGCGACTGCTGCTGCTCTGTAGACAAGAGACGGCACTAGATCGTCCTGTATTGTGGCGGGCTCTACGAGCGCTGTGGCCTACCTACCCAATGA
AACTTTTCATGGTTTATTTGACACCATCATCACCCATTATCTGAGCCCTTGCCAAATAACCCTCCGTTTAGGTCCAGGGCTAAATATCTCAGTGATTTAA
AGCCCGCGACGAAAAGGGTTAAATCCGCAGCAAAAGCTCACGAGCGCCATTCGTCTAATTCGTCTAATAGCAAAGAGAGACACGAAGCACCCGCACCATG
CCGCCGAAGGGAAAGAAGACCGAAGAGGTAGATAGACCCAGTAACGTCACTGCAGGTGGGGACGCCTCCTCTCTCTAACTCTTATGCTGTCGTCCTCCCT
CTCCACCCGCAGACCACGCGCACGTACCTGGGCCGCCCCGGTAACAACGTCAAGATCGGCATTGTGGGTGTCCCCAACGTGGGCAAGAGCACCTTCTTCA
ACTGCCTGTCGAAGCTGCACATCCCCGCCGAGAACTTCCCCTTCTGCACCATCGACCCCAATGACGCCGTGGTGCCGCTGCCGGACCAGCGCTTCAACTG
GCTCGTGGACAAGTACCAGCCCGCCAGTGTCGTGCCGCCCGTCATGTCCATCACGGACATTGCCGGCCTTGTGCGCGGCGCCGCCGAGGGCGCTGGACTG
GGCAATGCTTTCCTGTCGCACATCCAGGCCGTGGACGCTATCTACCACATGGTGCGCGCCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGG
ACCCGGTGCGGGACATGCAGATCATCCAGGAGGAGCTGCGTCTCAAGGACATTGAGCGCGTCAAGAAGGAGTCCCAGGGCGTCAAGAAGCTCGCGGAGCG
CGGCGTCGGCGGCAAAGAGAAGAAGGTGGAGTACGAGTCTCTGGTCAAGATCCAGGAGTGGCTCGAGTCCGGCAAGGACGTGTCCTTCGGCACGTGGAGC
GCCCCGGAAGTCGAGCTGCTCAACACTATGCAGCTGCTCACGGCCAAGCCCGTGGTCTACCTCATCAACGTGAGCAAGCGCGACTACCTGCGCAAGAGCA
ACAAGTACCTGCCCAAGATTGCCGAGTACATCAAGGAGCGTGGTGGCAACGAGCCCGTTCTCCCCATCAGTTGCGAGTTCGAGCTGGAGATGCTGGACCT
CGAGGCTGGTGGCGAGCTCGAGACGTACCAGAAGGAGAACCCGACGCACAAGTCCATCCTGAATCGTGTGCTCCGCATGGGGTACCACGCCCTCGGTTTG
ATCCACTTCTTCACGGCTGGCAAGGACGAGGTGCGCGGCTGGACGATCCGCAAGGGCCGAATGGCACCCCAGGCGGCTGGAGTTATCCACACGGACTTCG
AGAAAGGCTTCATCATGGCCGAGGTGCAGGCGTTCGCTGATCTGAAAGAGCGTAAGTTTGTCTTTTCTGTTTGTGGTGCTGCGCGGTGCTGTTCAACTTT
ACTAACTTTACGTTTTGGAATTGTGCAGTGGGCACGGAGGAGGCGGTCAAGAAGGCTGGCAAGCTCAAGCAGCAGGGCAAGAAGTACGAGGTCCAGGACG
GCGACATTATTTTCTTCAAGTTCAACAACTAGGTAGGTCAACTGCTGCCGAGTGGTGTTGAGTGAGTCGAGCAACCGTGGTGCCAAGACCTCCGTTTTAG
CCATGTGTGGCCTGTGGTTTTGAGCCAAGTGGCAGGTAATGTCTTCGGGTCTAGAGCATGCGGATTGAAAAGCGCGGTTGCAGAGCATCCCGCAATGAAA
TAAAGCATGCGCTTTGAGCACACTGGTCTACCACAAGCAAGTTCACACAAGGAGCAAGTGCGCTGTGTTTGGTTTTGGTTGCAGGAATAACGACTTGGAG
CTGAAGGGGCTGCGATATCTTGGATTTGCCTTGACCCGTCGCGCCTCTTGCAACTGATCGCGTGGAGTTTTCACTCTGTGGCCTCCACTTAGCTCGGCGG
ATACGGCAAAGCACACAAGCTCCAAGCCGAGGTGGTTTCGGTGTCGAGGTGAACCAAGTGGAAGGAATTCCGCCAGAGCGTCATCTAGGCAGCCCCCGGA
AAGGGCAGAGCCGAAATGGTGTGTCACCTGGCCTGGTTGTTTTGTGCCTCTGCTGATTGAATCGTCTTATTGAATATGTTGTTGGATGCTTGGTGTTGAC
AGCCTATCGGGTATGGATGCGAACCAGAACTAGCGTGGATTGCGCCGAAACAGAATGGAGAAATCCCTGTCAAGCGATCTGGGCACTCGTTCACCTTGAA
AGGCTCGGAGACGGAGACTTCTGTCTATATGTTTGGTGGCTGCGATCATAAATCGCCACCAGGACCGACGAACGAGCTGTACAGGCTAGACGTCACAAAC
GGTAGGATGATCTGCAGGGTTAACCTTTAGTAATCAGAGAGTAACTCGATTTTGCTGCAGGTTACACGTGGTCGAAGGTAGCAAGCTCACAGAGTGAAGA
CGATGTGCCAGCGCCGCGATGGAGGCACTCAGCCATCCTATTTGAGAAGAACATCATCATCTTTGGAGGCTTCGCCGCTGAAAAGCGAATGAATGACCTC
TGGCTCTTTAACACCGAGCTGAAGGTGTGGGAGCAGAAGTATGCTCAAGGTTTTTGGGAGGGGCTACCGCAATGCCGCGGTGCACACAGTGCCACTTTGG
TAGATGAAAAGATGTACGTATTTGGTGGCTATGGCGGCAACGGCTTTGGGCGTACCGACTTCAACGACCTTCACGCGTTGAACTTGCACTCATTTAAGTG
GCAAGAGATTCAGACTGAGGGTGAGAAGCCTGAGCCACGATCGGGCCATCAAACGTGCCTTGTGAAGGAGCAACTGCTTGTCATCGGAGGGTGGAACAGC
TTCAAGCAGTTTCAAGATATCTTCGTTTTAGACATACCAACCAAGACATGGAGCTTGCTGAGCACGTCGCTTCATTCTCCAATCTGGAATCACACGTGTG
TGAGTGTCGCCGCTGTGCCTTACTGGAAAGTGTTCTTATTTGGTGGAAACAGTGGAGATCTGGCCGAGTCTGGAACGGCGCAAGGAGCTTATTTGAACAG
CACTGCTGTGTTGGATACTGGCAGTATGGTATGGCTAAACCCGCCTGTCAAAGGAGAGCCTCCGAAGGCCCGCGCTGATACTGCGATGGTGTTTGATGCA
AATACCAATCACTTGATCTTCTTTGGAGGATGGGCAAATCGCTGGTACAATGACTTACACGTGCTTAATGCAAGCGAGATCGTTGGGCCGCCGTACTCAG
TCCTGTCGATCGAACCAAGGCAAGGTCCGATCACGGGAAATGCAAAGATAAAAATTTCTGGCTTCAACTTCACTGGCCAAAACGCTACACTGCGCTTCGC
AGTTGCGAAAGGCTCTGTCGACGTCACGGGAGCCGTTCTCAGTCCTAGTGTTATTCAAGCTACAGCTCCCAGCTTCGAGAAATTTGGACCGTTGACTTCC
GAGGTTCGAGTGTCGTTGTCCGGGGGCATGTACACAAACGTCTCCACATCCTTCCGTTTTCACTCCGTCACAGCAGCCCCAAAGTCGCTAGCATTTGGTC
CATGCTTAATTGCTGCCCTCAGTGATAATTGCCTGGCTGAGCTCCCGACTACATTTATCATCCAGACCAGAGATAAAGACGATAATCCGCGTGATTGTGG
AGGGGATGAGTTCACCATTGCTCTAAAGAACTGTGATGATGCCGAAGCCGAAGTGGAGCTGGTTGCATCCATCCTTGACAAAAATGACGGCACCTACGTG
GTGACATTTACACCATCTAAGGCAGGCAAATACGAGGTCTCGGTGGATTTTACTGGCACGTTTAGTGGTGTTGCAGGCCCAATTCGCGGCTCACCGTTCA
CCGCGGTATTCCAGCCGCCATCGGATGAGAATAAAACAAAGTGTTTGCCACCACTTGCAACTCAGAAGGACTTTGACTCGCCAGAGCTGATCCGGCGTGT
GATGGCCACAATGAACAAGCGCAACGGAGAATTCCGGCGCATTCTTGTTGACTTGCGGAAAGACATCCCGAATAACGATACAGACGGCCTTGAGACTCTG
CGGAAGATGAAAGAAATTATCCGCAAGCTAGAGACAGAAAAGGCAACGAATCACTTGATTCTGGACCAAGTGCGGCAGCTATTCTTCAATATCAAGAAGA
GTGGGGGGCATGTCGACAAGGAGCTCGTAGAAATCGAGAATATGGAGAAACTTTTTGTGGACGTCGAGAAGCAGATCCCAATGACCGAGAAGCGCACCCA
GGAACCCACGCGGATTTTCAGCGAAAAGACAGAGGAGAAGATTATCGCGTACGAGAAGATGATCGCACAAAAGGTGGAGACTCTCAAGACGCTCGATTTC
TGGTCATCAAAGTTGGAGCCTGACAAGGGTCTTGAGAAAATTGAGAGTTATCTTGTCGACTGGAACGTGGAGATGAAGAAGTGCGAAGAAAACACTAAAT
TGTGTTCGACTTTCGGGTTTCCGCAACTAATGAATGAATCGCTTCGCATGATGGGTCTGATGCGGGCAGATGCAGATGCAATGAAAACCGTATGGGCAAT
CATTAAGCGTGCAAAAGTTTTTTTCCAGGCAACCCAGGACTTATTGTTCAAAGAAGTGGACGTGAATGCGCTGCAGATTGAAGTTCAGTCTGCATTGAAA
GAGCTCAAAAAGATCCCCAAGGGGATTCAGTGGAGCGATGCGTACACCTCGATTTTGAAGGAATGCCAAGCATTTGATAAGACGCATCCACTTATTCGGT
GCGTGTCATCCAGCTACATGCGACCTAGACACTGGAAGCGTATCATGGCTCACACGGGAGAGTTCCCTACACCGGACGAAGACCCAGAACAGCGGCTATC
CCTGATTTTGAGTAAGAATCTGTTCAACTTCAGTTCGGACATTAATGAGATTTGCTATGAAGCTGAGAAGGAACAGGAACTCGAGCTTAGGCTTATTGAG
CTCGAGGCACTGTGGGCAGAGGTCAATTGGGAGATGTCTCCATACAACCCCGGTGCTGCCGAAGATGACATTGTTCCTCTCCTCAAGGTGTCTGAAGAGA
ACTTTGAACTCCTGGAGACGCATCAAATCGATGTACAAGGCATGAGCGCGTCACCGTATCAATCTGAGTTTGAGCCTCGCGTCGCGAAGCTTCAGATCGG
ACTTTCATCCATCAACGAAGTGGTGCTACTGCTGGGTGACATCCAGAGGTCGTGGAGCTACTTGGAACCGTTGTTTATTCAGTCTGAAGAAGTGAAAAAA
CAGCTACCGGAGTTGACCTCTGACTTTGAAGATATTGATCGAGAGGTCCGACAAATTCTGAAGACAGCGTGGAAAACGCTAAATGTGCAGGAAGCGTGTA
CCGACCCAGGTCTCATCAAACGATTGGAGCTTATCGTGGAAAAACTAGAGCTATGCAAGCACCGCCTGAAAGAGTTCCTGGACGGGCGCCGCCGCCAGTT
CCCACGATTTTACTTTATGTCCGAAGCAGACTTGCTGGATATCCTGTCGAATGGATCTCACCCCGACCGGATTATGCCGCACTGCTCCAAAATCTACTTG
GCGACCAAGACGCTCACTTTGGTAGATCGTGGCGCGGGAGAGCGGCCGGTCGCAACATCTTTCGTGGCTGGTGTTGGCCACGAAATTGTTGACTTCTTTG
AGGCCCCAGTGCTTGAGGGAGAAGCAGAAATTTATCTGGAGACTATCATGCGTGCTATGAGACTGACGTTGTTCAAGCATATTGATCGATCGCTTGTAGC
TTACACGGAAATGCCTCGTGTAGACTGGATCAACTTTAAGGATGACACAAACAAGCCGATGGATGCAGCCCAGATCATTCTACTGGCAGCAGGAGTGCAT
TACGTTCAAGAAGTGGAGCGTGCCTTCCGTAGCATTCAAGGTGGCGAGAAGGATGCCTTGAAAAACTACAACAAGATGCAGGAGCAACAGCTAGAAGACC
TGATTAAGCTCACGCAAAGTAATATTTCGTATGCAGAGCGACAGCGAGTGATGGTACTTATTACGATGGACGCCCACGGCCGAGATATTGTAGCAAACAT
GATTCGTGCCGGAGTGGAGGAGGCAACTCACTTCCAGTGGCAGTCCCAGCTAAAACACTACTTTTCACCAGCAGCGGGGAGCTTCTTGAAACGTGATAGT
ACATTCCGTGGAGCAAACAATGCTCGAGCTCAGATTTTAATTTGTGATGCCGGTATTCCGTACGACTACGAATATCTTGGAAATGGTCCCCGACTGGTGA
TTACCCCACTGACCGATAGAATTTACGTGACGGCAACGCAAGCACTGAACCTGCAAATGGGATGTGCCCCTGCTGGTCCAGCTGGTACGGGTAAGACGGA
GACAACAAAAGATTTGGCTAACGCACTGGGGAAAGTGTGTTATGTGTTCAATTGTTCCCCCGAAATGGACTTTAAGAGTTTGGGAAACATTTTCAAAGGT
CTTGCATCGTCGGGTTCGTGGGGCTGCTTCGACGAGTTCAATCGTCTCGTGCCAGAAGTGTTGTCGGTGTGCTCTGTCCAATTTAAGGCTGTATGCGACG
CGTGTAAAGCTGACGACGAGAGATTTATCCTTGAGAATGACGAGGTGATGCTTGATCCAACAGTTGGTGCATTCATTACTATGAATCCAGGCTACTTAGG
ACGCTCTGAGCTGCCCGAAGGTCTGAAAGCGTTGTTCCGCCCGATGACTGTCATGGTGCCCGATCTGGTGTTGATCTGTGAAAACATGCTTATGGCAGAA
GGGTTCACCCAGGCCAAGATCTTGGCATCAAAGTTTTACGGTTTGTATTCATTGCTAGGGCAACTTTTGTCCAAGCAGCTGCACTACGATTGGGGCCTTC
GAGCTGTGAAGAGTGTGCTATGCGTTGCCGGCGCATTTAAACGTGCAGAACCAGACATTCCTGAAACGGACCTGCTCATGCGCGCGCTGCGAGACTTCAA
CATCCCTAAAATCGTTGCTGAGGATATGGTTGTTTTCTTCGGTCTTCTCGGAGATCTGTTCCCGCGTGATAGTCCGAATGTGGACGTTCGGAACGACCCT
CCGCGTAAGCGTGATATGGAGCTTGAATCCATGGTACAGGGCGCTTCAGAAGCAATCGGTAATACACCTCGCCCAGAGTTTATGCTGAAGGTTGTGCAGC
TGTCAGAATTGTTGGCGATTCGGCATTGTGTCTTCGTGATGGGGCCACCAGCTTCAGGTAAAACAGAGACTTGGAAGACGCTGAAGAAGGCTCGCGAGAT
CATGGGCACTCCTATGGAAGTCCAAGACCTAAACCCAAAATCGGTGAGCACGAACGAGCTTTACGGGTATATCGTGCTGAAGACACGCGAATGGAAAGAT
GGCTTGCTGTCTCGAATTATGCGAGATCTGGGCTCTCGTCGCCGTGATAATGGTGATGAAGACAACAACCCCAAGTGGATTATTCTTGACGGAGATCTTG
ATGCTAACTGGATTGAGTCGATGAACTCAGTCATGGACGATAACAGAATGCTTACGTTGGCCTCGAACGAGCGTATTCCACTGAAAGTTCACATGCGTAT
GATCTTCGAGATCCGTGATCTAGTCTACGCTACGCCGGCTACCGTATCTCGTGCCGGCATTCTCTACATTTCAACATCAGAGGGCTACCAGTGGCGCTGC
CTGATTGACAGTTGGCTTGATCGACACTGTCAGCAGCCTGTGGATCACCGCCTCAGAAATATGATGTTCACCCCAGACACGCGCTCCAAATTCCAAGCGC
TTTTTGATCAATACATCGAAACGACCCTTCGGTTCTTCCGAAAGAAACTCGTCCCCGTGGTCCCTGTAGAAGAAACGACGCTCGTGACGAACTTATTGAA
CATGATCGATTGTCTGCTGACACCCCAAGTGTTGGAAGATTACACAGTGATGCAAAACACGTTCGTGTTCTGCTGTGTGTGGTCGTTTGGATCCATCCTC
ACCATGAGTGACGATGGCACGGACTACTCAGTCGAGTTTAGCAACTGGTGGAAAAACCAATGGAAGGACGTTAAGTTGGTGGCATCGGCCAGCAACACGG
TGTTTGATTTCTGGCTTGACCCGGAGACTTCGAAGTTTAATTCGTGGTCCAAGAGTCCGTACTTCTACACGGAGACGTATGTATCCCCAAGCCCAATCAA
TCAAATCACAGTACCCACCACCGAAACTGCATCCATTGCATTTTGGCTCGAGAACCTTATCTCAAAGAGCGTGCCGGTTATGGTGTGCGGGCCTGCAGGT
ACGGGCAAGACGCAGAATATCATGGGCATGCTAAAAAAGCTCAGCAAGGACGAGGCAACGGCTGCGTTCCGCTACTGTACGATCAATTTCAACTTCTACA
CCACGAGTTCCATCTTGCAGCAAACCATGTTTGGACAACTGGAGCGTAAAACCGGTATCAATCTTGGTCCACCCGGCAAAGCACGACTCATCTACTTCAT
GGATGATCTTAATCTGCCAGAGGTAGACCCATATAACACACAAAGTGCTATTTCTCTGCTGCGACAAGTGATGGAGTACAGACATTGGTTCGACCGCGTA
AAACTTCAGACGCAAAACATTCTGAATACGCAAATGGTCTCCGGCATGAACCCTACAGCAGGTTCATTCCTGGTTGACCCTCGACTCCAGCGCCACTTCT
GTACATTTGCTATGGGTATGCCTGAAGCACCAAGTCTGGTGACGATCTATGAAACGTTCCTGGGTGGGCATCTATCAGGCTTCGTTGATGAGCTGAGTAA
CTCCCAGTTCTCTAACGCGCTTATCAAGGCTGCATTGAGTTTGCATGCCAGCGTTGTGAGCACGTTCCGCAAAACAGCAGCCAATTTTCACTACGAGTTC
AATGTGCGCCACTTGTCCAATGTATTCCAAGGGCTTATCGCATCAAAAAAGGATCGTTTTAACAGCCAGGAGAAGTTCGTTTTGCTGTGGCTGCACGAAA
GTGAACGCGTATACGGCGACCGACTTGTATGCAAAGCCGACATCGAAAAATACAACCAGCTCGTACAGATGCAAGTGAAAAAGTCATTCGCGTCGTGCAA
CACAAGCCGATACTACGCTGCCGAGAACTCATGGCCCCTCATCTTTTGCCACTTCACTAAAGATGGCGATAGCGAGTACGACCAAATTATGGGGACGAAC
CTGGACGATCTCAAGATGAACCTGCAAATCCAGCTGCGCGAATACAACAACAACGAGAACAATACGGCTATGCAGCTGGACCTGTTCGATGATGCTGTGA
AGCACGTGGCTCGCATTGTTCGTATCTTACGAAACGAAAGCGGGCATGCACTACTGGTAGGTGTGGGAGGTAGTGGCAAGCGCTCGCTCGCACGCTTAGC
CTCGCATATCTGCGGCTGTACTGTTCGTCAGATCACGATCAGTTCAAAGTACGGCGAAAATGAATTCAAGGAAGATTTGCGCAAAATGCACATGGCGGTA
GTGGAAATGCTGTCTCGTAATGAAGAAGATGGAGGTGTCGTATTCATGCTCACTGATTCTCAAATTACGAACGAAAAGTTCCTCATCTACTTGAACGATC
TGCTGGCGTCGGGAGAAATTCCAGATCTGTTCGCGATGGAGGATATGGACAATATCGTCAACTTGCTGTCTCCTGTAGCTGGTACGAAGGACCGCAAGGA
AGTTGTCAAGTTCTTCCAAGCAGAAATCCGTAAGCGACTCCACTTGTGCCTATGTTTTTCGCCTGTAGGTGATGATTTCCGAAACCGTGCACGTAAGTTC
CCCGCACTGGTGAATTGCACAGTCATTGATTGGTTCCAGCCATGGCCTAAGGAAGCTTTACTTTCTGTCGGTCGCGAGAAACTGAAGGAGATTGGAGATC
TGCTTGGGTCAGATGAGTCGCGCGCGGGTATTGAAACATTTATGCCGTTCTCATTTCAGTCGGTGAATCTCTGCGCCGAGCGGTTCTTCCAGGTGGAGCG
CCGCCACGTGTACACAACACCCAAGTCGTACCTGGAGTTGCTTCAGCTGTACAAAAAGATTTTGCGCAAGAAAGTGGAGGAGTACGCTGCAGCCATCGAT
CGATTGGAGAAAGGACTTCAAAAGCTTAAAGAAACTGGTGATACCGTGTCGAGACTTGAGGTGGAGCTTAAGGTTATCCTTGAGGCTGCTGAAGACAAGA
AAGCTGTAGCGTCTGGTATTGCTGAGGCTGTGAACAAAGAGAAGGCCAATGTGGAAACTGAAAGTAAAAAGGCTGGTGACGAAGCTGCAAAGTGTGCCGT
TATCCAAACTGAGGTTACAGAGAAACAACGTTCAACGCAGGAGGATCTTGCAAAAGCTGAACCTGCTGTAGAACAGGCTATGGCAGCACTTGACTCGTTG
AACAAGAAGGATTTGGGCGAGTGTAAAACAATGTCGAAGCCTCCTGCTGGTGTAGACGATGTCTTTTCAGCTACCATGGTTCTGCTGGCTGGTGTCCACC
CGAACGTTCAAGTTACCAAGACTGGTAAGGTGAAGGATGTCAAATGGGACACCGCCAAGAAGCAGCTTCTGGGTAACATCCCTGAGTACATTGACTATTT
GGTGGGCTTCAAGCAGGTCGTAGACGACGGCAAGGTACCTCTCACGAACTGGAAAGAGGTGCGCGTGTTCTTAGAGATGGAACACTTCAACTACGATACG
ATTCTCACAAAGAACAAGGCTGCTGCCGGTTTGTGTTCATGGGTCATCAACATCGTCATGTACTACGATATCGTCATCACGGTCGAGCCGAAGCGACAAG
CTTTGGCCGCTGCCAACCTTGAGCTTGAGGCTGCAAATGCTCGTCTAACCGAAGTGACCGAGCTTGTGGCTGATCTGCAGGCAAAGCTAGACAAGCTGCT
GGCCGAGGCAGCTGCAGCCGAGAAGGAGAAAGAAGACGCAATTAATGCTGTTGAGACCGGAAATCGCAAGATGAAGCTCGCAGGCACCCTGACTAATGAT
CTTTCAAGTGAAAACGTACGTTGGGGGATCAATGTGCTGCAACTTCAAAAGGAGAAGGATCTACTGGTGGGCGATGTGCTGCTTGCATCTGCTTTCATCT
CATACATTGGCCCGTTCACGAAGCCCTTCCGAGATGAACTCATTAACAAGCATTGGGTGCCTTACCTGCGCACTGCAGCCGGAGGTGAAAGCATTGCTAT
GTCGGAAGAAGCCAACCCACTACTCATTCTGACAAACGATGCGCAGATCGCCGAGTGGAACACTCAGAAGCTTCCGTCAGATCGAGTGTCAACGGAAAAT
GGTGCTATTGTGGTGACCACAGTGTCTATGGGACGAAGACCACTTATCGTCGACCCGCAGTTGCAAGCTATTGCATGGATTCGTGAAATGGAAGCGCACA
ACAACCTTATCATTGTGCGAGTTGGTCAGAAAATGTGGATTGAGCGTCTCAAAACGGCAATTGGCACGGATGGTGCCTTCCTCATCGAGAACTTGGGCGA
GAAGATTGACCCCATCTTGGCTCCTGTCATTCAGCGCTCAACTTCACGTCGTGGCGCCCGGTACGAGATCCAAATCGGTGATGCTTCCGTCCCGTACAAC
GACAACTTCCACTTGTACCTGCACACAAAGCTGGGCAATCCCCACTACCCGCCTGAGATTCAAGCAGAATGCACCATTGTTAACTTTACTGTCACGATGC
TTGGCCTTGAAGACCAGTTGCTGAACCTTGTTGTGTCCAAGGAACGCCAAGATCTGGCCATTAAACGCGAGAAGTTGATCCAGGAACAGAATAACGGCAA
GATCGAGCTCAAGAAGCTAGAGGATGATATCCTGTTCTACTTGGCAAGTGCAGACGATGATATCACGAACAACCAGCCGCTTATCCAGATTCTGAGCGAC
ACAAAACACAAAGCCCAACGTACCCAGAACAATATGGAGGCTGCTAAGAAGACGCAAGAGTCCGTGAACATTACGAGTGAAAAGTACCGCAGCATCGCCG
CGCGAGGCTCGTTACTGTTCTTCCTGATGAACGACATCAGCAAGGTGCACTGCTACTACATCTACTCGCTGGCATCCTTCCAGCAGGTTTTCTTGTCTGG
TATCTACCGCGCGCCAGCAGCGAATAATCTCATTGCTGATGGTGCAGGAGAAGGTGAAGCTGCACCTGCAGCTGATGCTGGGGCAGCAGCCTCAACGGAA
GGTGGAGACGACGGAGGGGGTGATGAAGATGCTGAGGAGACCGAATCCGCCGTCGCAGATCTGACAGATGAAGAGATGAAGGAGCGATGCCAAGTGCTAA
TGGACAGTATCACCTCGTGCGTGTACAACTACGTTCGTCGCGGACTCTTCGAGCGCAACAAGCTCACGGTAGCGACAATGTTGTGTCTGAAGATTTTGCT
GAAGGACGGGTTGTTGAGCGATTCCGAAGTCGAGTATTTCCTCATTAGCAAAGCCCACCCGGACGCAGGAAATGCTGGATCAGCCTCAGAGTGGCTCCCT
GCAGCAATCTGGGCCAAATTGAAAGCACTAGAGAGCGCCAAGGTCTTCCAAGGCCTAGGAGACGCGATCCAAAATGACCCGGACGAGTGGAGAAAGTGGT
TTGCAACCGAGGATGCCGAGCGACAGAAGATCCCGGGGGACTTCATAAAGCTTACAGCTTTCCAGCG