Description :
From Genome Similarity Track
Location :
Scaffold_17:159738- 162328
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007142Similar to Lgr4: Leucine-rich repeat-containing G-protein coupled receptor 4 (Rattus norvegicus)

Sequence
2590 bases(100 bases per row)
CGGCGACGACGAAGACCGGTCGCTCAACACGCTCGCGACTCTCTCGCTCAACACGCTCACCACGAGCTGCAACGGTGGCTGCAGCGCCAACAGTCCGTGC
GTCGTGCTCGGTCAGTCCTCGGACAACGCGATCGACTGCGTGAACGACGTGCGCTGCGCCACGCTGCTCAGCGGCAAGACGGCGTTGTGCATGGAGCCCT
TTGGTGCGAGCGACGCCACGTGGGCCTTTGCTCCCGCCAAGAGCGACGACACCTCGGGCGTCGCCCCCTTCGAGCGCGTCGGGCTCGTGCAGCTCGGCGA
CCAAGTCACCGAAGTGTGCGTGCTTTTCCATGCTCTTCTATCCGATGTTCACTCTTGGTGTGATAATTGTTGTTGATGGTATTGATCCTTGTCAATTAAT
TGTCATAATTACTGCTGATTTATGTAGGGATTTTAAGATCGCGGCGCCGACAATGACTCCGTTGACAAATTTGGACATCTCGTCGCTCAATGTGCAGCCG
ACAACGACGCTCACCAAGATGTGCGTTTCGTAATGCTTTCCACACCTTCCAGGTCTTCAGGAAGTCTCATATGTCAATTTTGTGTCTGTGATTCTGTGTG
CGCAGCTCCTTCTCGGATCTCATCCTCACGGGCATTGATGGCGCTCTCCCGTTAAACGGGGCCAAGCAAATGTGAGCCCCTCCTCTGTTGCGTGTTTTGT
CTCTATGAATAGTAGCCTGACTAATCTTCATGATGTTGTCTCTCACTTATGCCCCACAGTATCATCAATAACTGCCGCCTCAAGACCATCCCAACCCAGT
TTATCGCAGGCAACCAAGTCGCGTCACTGTATGAACTTTTTGCTGAAGTTTGTGTCCATCTTGCTAGCATGTGCTGACTCATGCCTTCATTTCATGTAGT
GACCTCTCCAACAATGGCATCCTCATGGTCCCAACGGATTTCCAGAACCAAAGTTTCCCTACACTCGCAGCGCTGTACGTTCCTCCTTCTGTATTCTAGC
CGATTCGATCACCAAAAGTCACCAACTGATGCTGTTTTGGTAGGGATCTGTCGAGAAATGCGCTCACGACGTTCAACATCCGTCCGTCCAATTTCCCAGC
ACTCACGTCACTGTACGCTCTTCTCACTGTATATTTCCTTGGATGCTCAACTGTGTGGAGTCTCTGACTAATCTGTCTTGTGTGAACACCAGCATTCTCT
CGAACAACCAACTCCAGACTTTTCCGACAGTGGTCTTTAATCTGACAACATTGCAGCAGCTGTCGCTGAACGGGAACCCGTTGAACGCGTCCACTTTGAC
CGAGGAACAATTCACATTCCTGGCGAACCTACCGTTCTTCTCCATCAACGGCACGACGGAGACCGATGTGTGTCCAAGCGAAGACGTGGTGGCAAAGCTG
AACAGCACGTTCACGTTCTGTGTGCACGGCAACAACAGCGAGAATATCACCAGCGTCATACCGACGACGGAGCCTCCTGCAACCGATGCGCCAGTCATCC
AGACGTCTCAAGACAGCTCGTCGTCCAAGACGTGGATCTGGATCGTCATCGCCATCGTCTGCGTTCTGCTGTTCGGTCTGCTCTTTTTGCTGTATCGACG
CAAACAACGGCGTGAGGAATCCCCAAAGCTCGCGAACAGCATCACGCCGTCGATCGCCGTGGGCATGGGCGACCTCGCGGACCACCCGTACATGGAGCTC
AACCCGCCGTCGAGCTGCAGCCAGACGACGTCGGACTTTGAGCTGCTCGCGAACGTCGCTGACGGGTACATCGCACTCACGCGGCTCTCGTACAACGACG
TGTTCCTGCACCGCATGATCCGCGTGAGCAGCAGATCGGAGCTCTGGTTTGGCGAGTACATGGACGAGTCGGTGATCATCAAGAAGATCAAGAGCAACGC
GGCGTCCAAGACGGTGCTGCGCGAGTTCGTGACCGAGATCGAGCACATGGTGGAGCTCAAGCATTCGCGCATCGCGACGTTCAAAGGCGCCATGTGGGAC
AACGAGGGCACGGAGCTGTGCGCCGTGGTCGAGTACGTGGAGAACGGCGCACTGCGGGACTGCATCGCGAGTTCCATGGGGCTCTCCGTGTCCAAGCAGC
ACGCGATCGCGCGCCAGATCACCGACGCGTTGGTGTTTCTGCATCAGAAGCGGATCGTGCACGGCCGCCTGAATTCGTTCAACGTGCTGCTCGACAGGGA
CTACTCGGCGAAATTGAGTGTGTTTTCGATCTTCCACTACGTCAAGTTGTCGCCGTTGGACGCTGAGTGCGGCATCTTCGCGGCGCCAGAGGTGCTCCGC
GGCGGCCAGCCGACGGAAAAGTCGGACGTGTACTCGCTCGGCGTGATCCTCGTGGAGCTCGACACAGGCGAGAACCCCGTGGTGAACGCGAAGCGAACCG
CGACCGCTGCGTCGGCGTCGGCATCTCGGAAGGACAATGAGTCTGTCGTGTCGCCGACGTCGCGCCAGATCGGGTTCCGACTGAGCGTGCACTGCTCGCC
CGTGCTCAAGGAGATCATCGCGGCGTGTCTCGAGAAGGAACCCGCGCGGCGCCCCAAGATGAGCGAGATCGCGTTTGCGCTGCAAACCGG