Description :
From Genome Similarity Track
Location :
contig_66:159706- 161202
Transcript NameFunction/comments
g9592.t1hypothetical protein
g9593.t1hypothetical protein PHYSODRAFT_523326
g9594.t1hypothetical protein PHYSODRAFT_522264

Sequence
1496 bases(100 bases per row)
GCACGATGCATCTTTCTGCTTATATGTTAATCGAATGGAAGCATATAACTTGACGAACAATGGCGGGTGCCAAAAGCAAACGCAACTTCAACTTTCCTGC
TCTTATAGAGAGTTTTTCTTGTAGAGGACCAGAGTCCCGAATTTTGATTCGGATTTTGATTATTTTGGGTGGTTACCCTGGACTCCCCCATAGTGAGTTC
GAGTCTGACAGAGCCCGAGGAATCGCCGTGGCGTAACCGGGTACAGTCTTCAGGTCAAGCGGCTTCAAGCTTCGCGCGCTCGTCGGAGCCAGATCTCCCT
GCCGCCATGGTGGGCAACAAGCACAAGAACGGCATCATCTGCACGTTCCCGGACTGCAACAGGCCCATGCGCACGCAGAAGTTTAAGATGCACTTCTCCA
AGAAGCACCTGAAGGAAGGCGAGGTCTACTCGGTGGAGCATCGGCGCCAGTACGAGGTGGCGAGGGAGGACAATGTCCGTACTATCGTGAAGCATGAACT
TATCCCCGCCACCGCTACCACTGCAGCACCGATGCTGTCGTCGGTGGAAGAGGTTTCTCGCACGGAGACCACGAACGCATCGGTGATCTCAACTGCTGCT
GTTGCTGCTGCACACGAGGCAATCCAGACTCAGGCGAAGGAGCTCGCCCTGCTTCAGTCACAGCAGACACAGCTTGCCTCGCACTACGTAGCCTCTGATG
TCAAGACGGAAGAAGCCGGTGACGCAGTGTCGCCGCCTGTCTCCGCCAACACGGCTTCCGTGTTGTCAGCAACCTCTGCTGAACAAACTAGCGGCAGCAA
ACGCCTGGCGTCGGCAATGGAAACCTCCCAAGGCGCCATCGATCCAACAAGCGCGTTGCTGATGCAGTTCATAGCGCTGATGGACCAGCGGTTCCAGGAG
CTTGTAGGCAAGATGGGCGAAATGATCGACGTGCAGAAGGATCTAATCGATACACTTCAAGCCAGCAACCCGAACGGACAGGCCCCAGCGTCAGCTTTCT
CGTCCGCCGTCGAAGTGATCATGAAGAGACGGAAAACAGAAATGAGCCCTAGCGGCAATGAAAATGGCAAAGCCGAGACCAATGTCGAGACCCAAGGACT
TGGTAACAACGGTGTCGTCTTGTAGACAGCGTGACGAGAATTGACTTCCTTGATATAACCTTTACCTCGCATCAAAGTTGCGCTCCCAATGTCAAAGTAG
CTCAAGGTAATGAAACCCAATTTACTCAATGTCAAAGTATGTCAAAGTAGCCATTTCGTCGACTGTCAATGTAGCCATTTCGTCGACTGGTCGTGGTGTG
CACCACACCTCGCCGTCTTCCAACCAATTCGCGCTAACAAGCAAAAAGAATGAGTGAGCAAGCGGTGGAAGCGTTCGGCAGCGTGGAGCAGACGCTGGCG
GCGGTAGAGGAGCATCTGGCCGTATTCAAGCAGACCTCAATGGAGGACTTTGTGGCCCCATTGAGCCCACTGGAGCGTGCGAAGGTGCAGGTCTCG