Description :
From Genome Similarity Track
Location :
Scaffold_337:15968- 18140
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_337-abinit-gene-0.54Protein kinase

Sequence
2172 bases(100 bases per row)
CTTGATGCCGCGGNNNNNNNNNNNNNNNNNCCCAGTTGATCTCGGCGAAAAAAGGATGGTTCTTGATATCTTGGACGCCGCCGCCTGGACGACACCCGAG
TCGGTACGTCGGGTCGCGTTCCAGCAAACCGGCGATGATGTTCTTCACTTCCGCGCTCAGGCCAAAGTGCGATGGAAACTTGAGCGGAGACTTCATGATC
TTCGTGCACATTTGCTCAATGTTGCGGTCAAAGAACGGCGGCCAGCCCGTGAGCATCTCGTACATGAGCGTGCCGAGGCTCCACCAGTCGACCGCTTTGC
CGTACTCGGTCTTCTTCTTGCGACTGATGAGCATCTCCGGTGCGAGGTACTCAGGTGTCCCGCAGAACGTCTTCGCACCAGAAAAGTCGCTGCAGTCGGT
CTTCGAGAGTCCAAAGTCCGTGAGACGGATGTGGCCAAACTCGTCCAACAGGATGTTCTCAGGCTTCAGATCGCGGTAGACAATGTCCTTTAAGTGCAGG
TGGCCGATCGCTGAGACGAGCTCCGCGGCGTAGAAGCGCACCATTGCTTCCGAGAACGAGCGGAACTTCTTGAGGTGGAAGAAGATCTCCCCGCCGCAGC
AATAGTCTGAGATCATCACGAGCTTGCTGTGCGTCTGGAACGCGAACCGCAGCGCGACGATGAACGGGTGGTCGATCGAGCTCATGATGCGGCGCTCGGT
CATCGTGTGATTCACCTGGCTGCGCTTCACCAGCTCCGACTTGCGCAGCACTTTCATCGCCAGGATTTCGCCCGTCGTCCTGCGCTTCACCATGTACACT
TTCCCAAATGAGCCCTTGCCGAGCATCTTCAAAATGTCAAAGTCCGTCATGCTGATGAGCTGGCTCGAGCCATTTGCTGTCGTGTTTGCTGTGGTTGTTG
TCGCGACCATGTTGCTGCCACGCAGGTGCGAAATATCGGTAAACAAGTCGGCCTCGGGGTCGTCGTCGCTCTGACCGAGTCCACCTGAGAGGAACTGCGC
GAGCTCGGCGGGACGCGGACGCAGCGTCAGCACGGCGTTCATGTAGTTCTCGATACCCTCGCGGCGCTGCTCGATCACATGGAGTGACAGCGACATGAAG
AACTTCTTGGGCGGGAAGTACATCTTGCTCACGGCCGCGTACTTGTGGCGCAGTAGCTTGTGGAGCTCCCGAAAGTGACTATACCGCTTCTCGAGCATCG
TCACGCGACCGCTCTGGTAGTACACGTACACTTGGAACACGGTGTAGCGTTTGCCGTCGCCCTGGCCCGCAGAGGATGAGTTGCCCGAGCGCGTCGACAC
GGCGGCGTTGCCTGCACTGCTCGTGGACAGTCGTGGGTCCGCGTCCTTGCCTGTCCACGTGGTCGATCGCACGTTGTTCGACGACGTCGTGACCATCGGC
GACGTCGAGCTCAGGATGCCGTGGTGCGGGCGTCCGTAGTCCACGTGCTTGGACTTCCACCGCGGGATCTCCACCTTGACGATCTCATTGTTGTCAGTGA
CTCGTCGCTGGGAGGTCGACGTCGACGTTGACCGGTCACCGCTCGTTGGCGGCGTGGACCTGCTGTTGTTCGCACTGGTGCTCGCTCGTTGCTGCTGGTG
GTGGTGCTGCTGTTGTGCTTCCGCTATGGCTTCGACATGGGAGAGTGAGTGCCGCAGCGGCTTCTGCGCTTTCTGCTGGACCTGTTGGGACTGCTGCTGG
TAGCTCTGTGAGCCGGTCGACTGCTGCGAGCGCGGGGGCTGCTGCTGCTGGGACCTACTACTACTTCCACCACTACCTCCATATCCACTGCTACTATTCG
TATTTGGCGCGTACTGCAGACTCGCGCTGTTGTTGCCGCTCGCGCGGTGGCGCGTGCCGGACGTCGCGCTGGTCGACGCCAAGAACGGGCTGTTGGCGCT
ATTGCTGTCAGCGTTGCTGTTAGCGTTGCTCGCGAGCTCGCGGCGCCGCGCGTACGCCTCGGGATTGGACGGCCGTGTGCGCGCGTAGTCGTCCGTGGCG
GCCGGCATGGGGAGCGAGCAAGGAGCCTCGCGGGCGTGAGGGCGTGGCTGTGACCTGGTGGTCTGGTGACCTGGAGAGAGAGAGAGCGCAAGTGGCACGC
ACGGGAGCGGTCCCTCAGATGGTTCGTTCGCCTGGTGATTATGGGCTGTTTGTCTTCTGCTGTTGTGCGCAA