Description :
From Genome Similarity Track
Location :
Scaffold_35:159644- 164783
Transcript NameFunction/comments
Physo_159355PsAvh439
Physo_134981predicted protein
Physo_134982hypothetical protein

Sequence
5139 bases(100 bases per row)
GTCCAAATATCGCACGTAATTGAAAAATATTCGCACGACTGCTCGATGCCGGCGCACACGAAAATCCTCATTTGGTCGGCCACCGAGATGATACACCCAC
GCAATTGAGCACGCTTGGGAATTGCCACGCGAACACCACACAACTTTTCAGTGATAAACGCAATGAACTCGAGGAAGCCTTCATCTTCGACAATAATCAG
CGGGCGAAAGTGCGCTGCAACCCACCGCGCGAGTAGCATATTCAGATACTTCTGCTCATCCGGACTGATCTCTCGAAGCGTAGCCGCTTCCGTGAGTTCT
TCATCGAGATTGCGTTGGACTGGTTGCTCATTTTCGCCACGGATGAACTCGTTTAGCTCACGAAGATGGTACCGCTCCATGTGCTGCGCAACCTTGTGTT
GAGACGTTTTAAACGCTATTGTCATTTTGCAACGGGTGCAAAAAGCAAAGGCGGCGTGCTTGTTTTCGAGCTCGGCGTCTGCCAAGTACCAATGATCAGG
ATGAGTAGCTAGTCGAACGAATTGCCACAGTTCGTGCCGACGCTGGCGTCTTGTTGTGAACAATCGTGGTGGAGCAGTGCTTAGACGAGTGCCAGGATCG
GGGACTTCTCTGTGAAGCGCTGCAAGATCCGAACGTGGGTCTCGGTCGCTTGGCGGCTCGGTCGGCTCAGTAGGGCGGCGTTTCTGGCTGGAAGTTCGTC
TTGTACTTGAACGTGCTGATCGCTGTTGCTTGTGCTGGCGGACACTCGATTGGTGCGTGCTGGAAGGGCTTGCTCGCTTTTGCTTCCGAACACGAGCCGA
AGTGCGTCTCGAGCTCTGCACAGAGCACCCTGCACTTACAGCAGGGGTAGCAGGAGGTGTCTGTGTATTGGCGTCTTGGGCGAAGCCATCTTGACCCGGA
GCTAGCTCTTGGCCATGTCTCGGAGACTGTGGACCATGCACTTGGGTGGCGTCGGTCTCCGTTGTGGGCTCTTGAAGCTCCCGGCTATCTGGTGGAGCAC
GAAACGCGCTCGTGGCGGGGCTTGCACGACGAAGCTCTTCAGCTTCCATCTCGAAGTGCCGTGTGCACACCCTCACGTTATAAACACAAGTTGTTAGAAA
AGTTAAGGGTTACTTTCGCGACAGCTCTACTTACTAAGCACTGCTTCGCGCAGCTGAGTAAGGATTGGTGCTACACTGTACTACAGTGTTACAGTAGTGT
ACTGTAAAGGACACGCTCCTGCTCACACCACCTTGAAGATATTTTTCGTGACATTGGACCAAGTTTACAGGCTAACATGGCCTCTTGGGAGCCGTGAATA
GCCAGAGTTCCCACGCTCAGTCTCCAATTCGCTCGCCATCACTCAAGAACAACAACAAAAACTTCTTTGCAGATGCGCTTCTGTTTGGTCGTCCTGCTCG
CTGCTCTGCTCGTCTTGACGAATTCACGCACGACATCGGCGGCTTCGGAAACCTACGAGGGAGCTGATGTCACGACGATTTCCAGCTATACCAAGCGCTC
GCTACGGACGGCAGAAGACAAGGAGGAACGAGGTATCACCGTCGAAGTGCCCTCGTTGGAGAAGGTGTCCTCCGTAACGGGAAAACTCCCTGCAGCAGTG
GTGAAACGTCCCAACAAGGCTGCAAGGCTCTTCCTGTACAACTTGTGGCTCGTTGTTATGAACAAGTCACCACAATGGGTCAAGCAACACCACCCTGCCT
TGGCAGATGGATATATGAGATTCCGGCTGAACAGACTTGTGGGCAAATATGCGTAGTCGACTTATCAGTCAAACCGTCGTACCACTTATTGGCACTCATG
ACGAACGATTGATCTGTAGAGTGGAGGCGTAAAATTCATCAACTTGTTCATTTTCCGATGCATCCAACTGTGTGCTCCACTGCCAAGCCGGAATTTTTGC
AGCAACACTACTTGCCTCCTACGAAGATTTTGCTGCTGGCTTGGTGCGAATCGACTTGGGCTTGGGGTTGTGCGGAATCGTAAACACCGAGACGCCCAAC
ACGTTCTTGACCTCCCACACGACGGTGATGACGATGTGCACGTACGCTGCGAGGGAGAGGAAGAAGAACTCGCGCACGATGAGCTCTTCGTTAATAGCGT
CGTAGATGCCTTCCAGCATGCAGAAGGCACAGTGACCAGCCACGTAGAAGATCGGCACCAGCGTCTTACGGAAGGGATGGTACTCCTCACCACACAAGTG
AGCCAGCATTAAGTGGAGCTAAACACAACAAGCAGCAGCCTCATCAGCTCATTATAAAATGCAACAATCAGCCACCAAGAGTAGACGTACCACCAGCTTG
CTGTTCAGCAGTCCAAGCATCCACAGGAACATCCGCGGGTGTGTGGAGAAAATGTCCGAGGGCGAGTAGAGGGCCCAAAGTCCAGCCAGCGTGTTCAGTA
TGACGAACGGAAGGAGACGCGTAAAAGCCACAAGAACCGAGTCTTGGTTCAGGCGTACAGCGTGGAGCGCATTCCGCACACTGTAAGAACAAGCAACAAA
GTTAATTAATCAAGGGCTCCACAATCAACAACACAATCAGAAGGAACGCGATAACGTACTTGACCATAAGCGTGAAGCACGAGCTGATCATCGTCACGAT
GACAAAGAGCGAGTTGTTCTGCACCCCTTCGACCATCTCCCGGTTCCAGAAGTCGACACCAACCGCCGCCGTGAACAGCTTCAGCGCAATGCCGATCAGA
ATGCCCTCCGTCGGCCCGTTAATGATCGGGAGCTCCAGCGACCCGGAGTAGTACCTGCAACAATACACCACACTGTCAGTCCAACCTCCTTCAACGCCAT
CCAAACTCAACCCAATCCGACTCACTCTTCCCACGTAGCAAAGATGAAGACAAAGTGTGCACTCAGCACGAACCCAAGCGTCCTCCACGTCGTGCCCATC
TGCAGAATACTGGCCATGGTCATGGTCCCCACCGACACGTTCAGCGCATCGCACCCGTGGTCGAACAGCAAGCCCAAGGGCGACGAGGACTTGGTGCGTC
TCGCCTGCTTGCCGTCCAAGTTGTCCAGCGTCTGGTAGCTGAAGAGCGCCACGGCCGCGGCCACCATGGCCCACCAGGGGGCGTCGCCCTCCAGCAGCGG
GCACAGGAACACGAAGAGCGTGTGCGAGCCGCCCACCAGGATGAGGCCGATGAGAGTAATGAGATTGGGTGCTAGCCACAGCGGCAGCAGCTCCACCAGG
AAGTTGTTCATGGGCGTCAGCACGTGCTTGTAGACCAGCGAGTTGTCGGCGCCGTGATACTCGTACGTCAGCAGCTTCTCCGAGCCCTCCTGCGACACGT
ACTTGCCGAAGTACGTGGACTTGCCGTCTCCCGTGCTGCGGTGCCGCACGCGCTGCTTGAGCGCGTGGATCTGCGAGGCTTCGACGGCGGCGGCGGGTTC
GAAGTCAGCTTGGGACATATTTCGGCGTTTGGCGAGCTGGAAGCTTGGGGCTGCACCGGTTGGATGGGATGAAGAGTGCGTTGGGTACGCAAGACGCTGG
GCTACAAGGTGAGCGTTGAACGGGCTTCAGGTGACCTGTGTGGGCGGAGATAGAGGCCGGCGAAGCGTGGGGTCACGAACGTCCTGGCAATGGCGACGAC
TGTATCGGAATGAGGCGACCGCTGGACCACGGTACCGTAGGTTGATTTGCCTCGCGTAGCTGATATACAGGATGATGGCGGAGCCTCTGTAACAGTGATA
TTAGTATGTATACACCGATATTACATTGGACCCTGTTTCAAGACTGGGATTTTTCATATTGAATGATCTGTAACGTAGTACCCTGTCTACTTGAATATAC
GCCTTGGTTTTATATCCAGGTTATGATGATGCCTCTGCCGCTCAACGTCACTTTATTGGCTAAAAAGATGTGAGACAGTGGCAGCCCTCACTAACTCCGA
GTTGTGTATGTCACACCACCCACCTTTTCCCTAAAAAAAATCTCATCTGGTCCTTCTCCATCCTCCGCCGTCGCTCGAGAAGATCGATAGATGCGTCTCC
GCTCCCACGTGCGCGCTGCTCGCGCTCTTCCCAGCTCCACCTCCTCCACCCATCAACAACCCGCACAATTTGCGGTGGGAGGCGCAGTGCTGTCAATGCC
AATGGAAGTCGACGGCGCTTCGGATTCCGCGGACGACTTTCCGCCCGTTGAGCTGTCCGTGCAGCGCCAACGCCGTCGAGAACGCGCCCCACTGCGCACA
CCTCGAGGTGCGATGGCTTCCAAGAAGCGGCGGCTGGTGGGAGGCGAGGAGGACGTGGAGGAGGCCAAGAGACGTCGCTTTCGCCTGTTGCAGGCAGCGT
TCGGCCCCGAGGACCGCGTGGGCGAGTCCAATTGGCTCACGGGCGCGCTCATCGACCTGATGCTCTGGAAGTTCGCGAGCCTGTACCCGGCGGTGCATTT
CCTGTCCACCGCCTTTTACCACTTCCACCTAGAGGCGGCCATGAAGGCCACTGACCGATCGCCGTGGCGTCGCCGGTGCCGGTGCAAGAGGGACTACCAA
GTGAAGGACGTCTTGGGGCGCGCGGTGAGCTACGACAGTGACACGCCCCTGGTGTTCATTGTGAACGTCGACCGCATCCACTGGAACTTGTTCCGGGTGC
AGCTTGGCCCGACGCCGGAGCTGCAGCTGTTCGAGCCGATGGGGAGACTCGCGTCGCGCTCCGGGATCTCGTACCGGTCCGTGCCGCGCGCAGTGGTCGA
GTGGCTGGACGTGTGCTACCCGCAGCACAAGGGCTGGATGCAGCGCGCGGTGAGCGCCATCACCAACAAGCAGCAGGTGAGCGGGTTCGACTGCGGGGTG
GCCTGCTTGCTGTACGCGGACAAGTGCGGACGCGGACACACTGGGGAGGAGATCAACGCGCAGATCGACCAGAAGGCCATCACGGCCTTCCGCAAGCAGT
TGCAGCTTCAACTGCACTCTCTTGGAGACGACCTTGACGGATGAGCGCGCGGCACTGCCGGTGGGTATTTATGTTGTACGCGGAGAGTTGCATGTTGAGA
ATGGAGTTCCGGCCCCACTGCCGTTGTGCCCACAACTTGTGGCTGGCAACAGACGAATGAACAGTGTGGTCGTTTTTCGCCGCTCGGTTCAACTTACCTC
TGAGACTAAATATTAGTCTTTGATACTTTATAGTGAAAC