Description :
From Genome Similarity Track
Location :
Scaffold_54:159601- 160934
Transcript NameFunction/comments
Aphas_H257_13808AlNc14C568G12167

Sequence
1333 bases(100 bases per row)
GTGGCAAGGGGATGAGCGGCTATGGATACCGGGTGCGGCGAATGACCTGATCCAACGGATTATGGTCGTTGCCTACTGCGGCAGCGCCGGGCACCGTGGA
CATGCAGCGCTGGTGGCTACTATCCGCCGCCTGTTCTATGTCGACCACTTACCCGACAGGGCCAGTGAATTCCTCCGTGGCTGCTTGTTGTGCCCTCATG
TAAAACGGGGGAGGGTGGTCCATCAACCGTATGCTCCGAGATGGCACGCGAAAGAGCGCAACGAAGGAATCCACTTCGACTAAGTATGTGCTGGTACTCA
AAGACGACCTTACCCACTACTGCGAACTCATTGCATGCGATGGACCCACGAGCCAAGTATGTGTGGATGCCCTGGTGGACTCGACGAAGCGGTTCGGAAT
GCCACGAGTCTGGGTCAGCGACCAAGGAACCCATTTCAAAAACGTGGCCATGAAGGCGCTAGCCAACAAGTTCAAGGTTCATCATTACCTAACCTTGGCC
TACTGCCCCTGGCGCAATGGAACGGTGGAGCGAATGAACCGCGACATCCTTCAAGTGATGCGGGTCATGCTGCGAGAGTACCAACTAGCCGAACAGGAAT
GGGACTACCTATTGTCAATGGTCCAAGCCAACCTCAACCAAACACCGGCAGCATCACTGGCGAGCAAGTCGCCGATGGAGCTGTTCACAGCTTTGAACCC
GGCAACTCCCCTGGATGTCGTCGTGGTGGGCATGAACAAGGAACTCCGAGAAAGCGACTGGACGGTCATGGACATCCCCAAAAATCTGGACAAGCTGCGT
GCTAGCCTGCAAGTCATGCACAAAGAAGTCCTAGACAAGAATGCGATGCGCGCGGCGAAAGCGACGAAAACGACCGAGAAATACGAACAGTGCAACGTCA
GCGAAGGCGACTACGTGCTCTGATCCCGTGTGGACGAACGCTATCACTTCAAGCTGCTCGTAACCTGGACTGGCCCCTACCGAGTCAAGGAAGTGGGCGA
ATTCTCCGTCGTTTTGGAGCACTTGGTGACTCACGAACTGCGGGAAGCGCACGCATCAAGAGTCAAGCTCTACGCCGAAGACAGCTTTGAAGTGACCGAA
GAAATCCTCGAACACGTTTCCGAGCAAATGATTATGCTGAAGGTCAAGTCCATTGCGGGACACAAGTTTGTCCCGCTTGAGAAAGACTTTATGCTGGAAG
TGCTTTGGGAAGGTTTTGAAGATATAGAGTCCTCATGGGAACCGCTGCAGAAGCTCATGCATGAATGCCCGGCCATCGTGAAGAACTACGTTGAAGGCGT
GAAGACAGCGAGCGAAGGCAATGCATTGCGCAA