Description :
From Genome Similarity Track
Location :
scaffold_1136:1596- 6027
Transcript NameFunction/comments
g11042.t1hypothetical protein

Sequence
4431 bases(100 bases per row)
TCCCAAGTCGCTCACCCATAGCTCCGGCGCTCCAAACCGGCTGTACCAGTCTAGGATCGCAGTAGCTGCAACAGTAGATGTAGGTTCATCGCACGCCACG
AGGTCGACAAAATGTGTGGCTTCATCTTTCAGAACCAACACGTAGCGAGAAGTGCCAAAAGAATCTCCCAGTGTCAAGAAATCCCAGTGCAGGGTCGCGT
TCCGTTCAAAAGTGTGGTGGGATTCGCTAAAAGGTCGGGGAATTACCGTCCCTCCCTTCACATGCAGGCAAAGCAAGCAGTTGGAGCAGAAATCCCGCAC
CATTCCGTTGAGACCACCAATGTTGAACAACCGACCGACGTGATTCTCCATCACATTGACACCACGGTGTCCGTTCCGTCCACAATGTGCAATAACCAAT
AAGCGTTGAGTTAGATCGCGAGCTTCGCGGGGAATCCAGATCCTGTCTCCCAGTCGCCAAAGTTCATTCTCATCCAGTGTTGCACCTTGCGGAATATCGT
GCAGAGCTTGCACACTACCGATTTCGTCAACGGTTGGCTAGACAAAGCCATCTTGATCGAGTGGACGTAGCGAATGTACCGAGCTCTGCTGTCGCCCGCC
GCGGCGGTGATTCGAGCGTGTAATGCGTTTGATTGAGTGGATCCGTGCTGCCGGCGGTGGCTTGCCTCCCCACCTCAAAATCAAGTCAGCCCACACCTTC
GATGTGCTCGATAGAGTACCTGCACTCTAGAAGTTTCGTCGACCAATGTAGCAGTTTACCGCGTACATGCCGCGTCAACTCTTTGTTCGGGCAGAATAGG
TAGATAATGTTCCGGTGGTCGCAGTAGAGCCTAAAGCCTTGTGGCCGCAGTAGCAGATTTTCGAGTTTCTCACAGGCGTGCACGATTGGGTAGAATTCTT
TTTCAATCACCGACCAATTGAGCGCTGATCCCGTGAAGCTTCCTCCCATTCACACCAGGAGCTCGTGGTTCTGCTCATGGATGGGTACATCCGGTTTCCA
GTCGTTCACCTGCGAGACTACCAGCCCCCAGCCTCGATCCGATGCATCAGAGAGCAGAACGAGCTGCTTGAATGGGTCTGGGTACGTCAGCATCGCTGAA
TTGCCGAGTAACTCTTTAACTGCTTCAAATGCTGCTCGTTCATCTGCGTTCAGGTCGATCTGCACTCCAGCAGCCGCTCGCTTTGTTTTCCTAGTTCCTG
ACAGTGCCTCATCAAGGCGTTCTTGAAGTGGTCGAGCAACGCGAGAGTAGTCGACAAGACCAGCTCTCATCCAATTGCTAGCACATAGAAACTGTTGAAG
TTCGGCTGCAGTAGTCGGCAATGGCATTTCACGAAGCGCCTGAATGCGCTCAGGGTCGTGGCCGACTCCGTGCTGGTTGATAATTCTACCACACCAGCGT
ACTTCCTTCAGGAACACTGCACTTTTCTTCGGGTTGACAATCAAACCGTGCTCGTCAAGCTTGGCGAGCACAGCCTCAATTGCATCCACTAATTCTTCCT
GCGTGTCGGCGAACACCAGTAAATCATCAATCCAGACTATCACACACTTGTTGACGAGGTCTCCAAGTACCATTTCCACAGTAGATTGAAAGTGTAGGGC
AGCAGTGCTCCCTTGAGGTACCCTGGTAGGCGTGAAGATTCCCTTGTCCGTCATGTATGAAAGGAACTCTTGGCTGCACTTGGACAAAGGCAGCTGCCAA
AAGCCTTTCAAGAAGTCGAACATCGCGTAGAACATCTTGCCCTAACAGTGTTCAAGTGCGACCTCCAAACTGGGCATCACACCAGCGATCGCCTCAGTAA
CCACATTGAGAGGTCGATAATCAGTAGTTTGCCTGAACTCGTCAGTGTTCGGCTTCCGGACAGGTAGGGCAGGGCAGCACCAGCGACTCTCGCGGTTCTC
GTATACCCAGTCTAGTTCAACCAGTCGTTTGTTGAATTTCTCCAGAAAAGCTGACTTGCTTGGACTATATTGCCGGACTTTACACCGGTACGGAGTGGCG
TTGGCTTTCACCCTGATCTTGAGTGGCGACACCCTTGCAGGTGGGTCGTCGCCCAACTCAAGTCTCAATCCTCCGTATTTACGCACCACTTCATAGAGCC
TACTGGTAATGTAGTCGTCGACGACCCCGCGGTCAATCGCGTCTTGTACGAGAGCATCCACAACCTTCATCACTACATCACCAACCGAAGGTTTGCATGG
CGGCATGCCATCAGGTTCCTCGAAAGAGTCATCATCTTCAGTCCCTCGCGACGGAAGATACTCAAGTTGCTGCTCAATATCGATTCCGAGCTCAGAAAGT
AGTGCTTTACCCACCAGCACCTCATCTTCATCTGACTCGACGATCAGACAACGTTTGGGGTCCTGACAGCGTACGGGTCCAGCCGCAGTGTTAAGTGTCA
ACCGTATATCGACTGCATGCGTCGAGGTTAGCAGTGCGCCTCCGACAGCGCGAGATTCTACTGCATCATCGAGTTTCACAGGTTTCACTGTCGGGTCTTG
CTCCTGGAGTAGTTGGACATGTTTCCGCGAAATTACATTCCAATCGCTCCCGTTATCAGCGCAATATGGCAGCTCCACTTTGCCGTTCAAAACAATAGTC
ATCTGACCATCATTCTCGGTTGCAGGTGCTTGTTCGAGTCGCTTCGATCGGTAGCGTTTGCCCGTATTGCTTTCGGGTACGTTTTTGCTTTTCGTTCGGC
GAGCAGAGCCTCCTTGGCAGCCTCATCCAGGTCGGGGCACTGACTCAACCAGTGATCCTTCCCACAGTGGAAGCAACCTGTCCTCGGCTTGCTCTTTGCG
TTAGCAGCCGGTTTCCGTTCCGCCTTTGGGGTTGACACCACGTTGCGATGCTCCCCAGTGTCGTTACGGACCACCCTAGCGTTCTTGCCTTGGTTGGCAC
CAGAACTTTGGCCTTTGTTCGATTCTCGGCGAGATTTTCCGAATCCTTCGCCTGGATGCTGCTGTCGCTTAGCTAGCAGCCGAAAGACCTTTTTCCTGTT
CGAGCGCCTTATCCTTGACGAGCTGGTACAGAGCCTGCTCATCGGTCTTACTGGAGCTGTCCACGAGCCGATGGTGAGTGTCCACCGCGTCACGTAAAGC
TACAGGCTCCAGGTATTGCTTGAGAAATTTGCACTTCTCCTTGATCCCGTTGGGGGTCGAAAGCATGCTACTCAGTCCATGCTGTAGGATGATGTCATCG
CACAACATGAAATAGTTTATCACGCGGGCCTTCACATCACCTCGCGCAAGTCCATCTTCAATCCTCGGTCAAAAAGGGCATCCACATCAACGATATCGTC
ATTCATGACGTTACCAATGATATTGTCCAATTCAGACCGAATTCGATCTTCCGTGACCTCCTCGATGGTCGTACCCCACTCAAACTTGCACAAAGTCTTG
AGCAGGTTGCGGTTGAACGAGTTCTTGATGCTCCGAAGTGCCTTCGACTTGTCTTCACCAGTCGCGGCAGAGTGAGCCTCAATCGCATCTTCATACTCCT
GTCGTTCCCTTTTCCACTTCACCAGAGCTGGATGGGAGACGTCAGTGACGTACGGCGGCATGATCGAAGCAGAAGTCAAAGGAACTGTTGGCGCCGAGAT
ACTTGCAGTCATCGTCGTTGCCCGTCCCGTCTCAGTCCGTCTCGTAGCTGCATCCGTTGTCGTCGTCGAATTTTGGTTCGCAGGCGTGGCTTGAGCCGCT
CGCCCACTGCGTGTCTTCATCATTCACGCGGTTACTAAAGTTAACTTTGTGACGTGTACAACAAAGATTGGGAGCTGGAACTCCCTGCAAATGCCTACTT
GTATTGTAAGAAGCCAATTGCAAAGTGACTTAGTCTGTCTACCTTGCGAGCGCTCTCTCCTGCCTCCATGGCAGTCCAGGGAGAGCAATAGTATATGTTG
AACATCAAGTTGCTGTTGTGCGAACAGCAACCAGATTGCTTGCCGTTGTGCGTGCCTCAACCATATTGCGGGTTGGAGGAGCTGACGCGAAGATGCAGTC
CTTGCCATCGCCACAGAGTTACACGAAGGTATCATGGCTACTTTAAGCTAATTTTCAAAGGCAGGTCCCACTAACTTTAGCACACATTCGCAAATCTGGA
GGGTCGTCCCATGCGCGCGCTTGCGCTCCTGCGGCCGCATACAAGCGCAAGTGCAAAGGGGCGGCTTGCGACCATTTGTCGCACGCCGAAATGGCTACAG
GGGGCCCTCAAATTTGTATAATTTCGGTGTAACTTGAACTACCGCGGTTAGAAATGCCTCCATTCCGTCTAGCTTTTCAGCTTGAAGTATGTATGTAAAC
GCGTTTCGCGAGCCGTCTTGCCACCGGAGTGGCTCAACTTCCGCATGCGTCGGGTTATCTCTCATTCTCTACGTTTCTCTCTTCTCTTGGCCAGAGTCCA
TTAAGCGGCGCGTACGCTATAAGCGACTCGG