Description :
From Genome Similarity Track
Location :
contig_76:159581- 161257
Transcript NameFunction/comments
g10084.t1hypothetical protein PHYSODRAFT_320696
g10085.t1hypothetical protein

Sequence
1676 bases(100 bases per row)
ACTGAGGAATTGGCGAAGGTTTTGGCTGTAGGGGTAGAATTGTGGCCATCCGTTTCTATTGTGATATTTAATGGCAAAATCAGGTTAGTGGACACCATTT
TCACAGTAGCATTTTGTGCAATAATGAACGAGTTGCAGCGCGTGCTGGACGCGTATCGCGGCATGGAGCCCGTGCGCGACCTCGTTGCCAGGATCAAGAC
GCAGTTTGCGGACGAGCAGCGCTGGGCGACGCTGGAATTCCAGGTGGGCAGCGGTATTTTTGACATTGGAAATGGTGGCACAACTCACGTGTCAATCATT
GGCTGCAGGCCCAGGTGATGCACGTGGTGGTGAACGACCCCGTGTGCGACGACTTCCCACCGCAGCGGAAGTACACGTACAGGTTCCTCAAGCGCTACTT
GGACGGTATGCATCAGACAAAACATTTTTCACATTTTGGTGAACTATCGGAGACAGTCGCCATTTTCGAGTGACCATTGTTGGTCTCTACCGTTGCAAGG
TCTGATCAATGTTGTTGCCGTGCATTTTTGTCGACAGAGATTGAGGCGGTGCAGGCGGATGCCGATGACGGACTCGTCGAGGCACTCATGGAATTTGTAC
TGAACGCCAAGCTGGCCGATGACTCGCTCAATGCTGAGGCAATGCACCACGTTTCGTACACGGTGCCGACTATCGACTCGTCCGTTGTCGTGTCCTGCCG
AGTAGCGTCCGTGTTCAACGAGGTCGGGCTCAAGCTCTGGGAAGCAGGATGGCTGCTCGCGGAGTACATCATCGCCCACGAAAGCGAGTTCCGCGACAGG
ACAGTGCTCGAACTAGGAGCGGGTGTAGGCTTTACCGGGATGGTTCTGGCCTGCGTGTGTCGCTCAGACCGCATTGTGCTCACGGACTACGCGCCCAACG
TCATGCAGAACCTGCGTTACAATGTAGAGATCAACGCCAGCAAGTTTCTGTGCCCGGTCGAGGTGCAGACGCTAGACTGGGAGACATGGCAACCCGAAGA
CCACGACGACGAGCGGCCCGACGTGCTACTTGCAGGAGACTGTGCTACGACGTTGCGGTATTTCCTGCTCTGATGCGCGTCCTTCAGTCGTTCCTCGGCA
ACGACGGAGGCAGCACGACCCAGCACCCTCAGCGCGTAGCAATTTTCGCGGCCACCATTCGCAACCAGAAAACATTCCAGACATTCCTCGACCAGCTAGC
ACAAAACCGCATTGACTACGTCGATATCACGGCTTCCTCGGGTGGACAGGTCTTCTCGTACCCGAACCGAGAGCAGATTCGCATTTGTCGCCTCTCGAGA
TCCATTCTCGACGAGGACGCACCTGCAGAAACGAAATAGTTTTTGTTTGTCGTATATTTCGTGTTACATGGAGTGCATCTTGACCCTGAAGAAGAACACG
CAGACGATGAACGCTAGCAAGCTGACAGCGCCGCCTACGAAGACAGGTAATCTGTAGCCCATTGATGTATCCACCAGCGCAGAACCGACGATGAAGTTGA
GCAACTGACCAGAAGAGTTGGCGGAGTTCATGACGCCTACGTACACGCCGATGTCGGCGGTGTGGCCGAACACGTGCACAATGAGTGGCACAACCAGTGC
GAAGAACGTAGCGATTGTGATCGATGAGAGAGCCACGACGATCAAGTCCACGGCCACCACGTCGCAGAAGGCCATG