Description :
From Genome Similarity Track
Location :
contig_76:15954- 17418
Transcript NameFunction/comments
g11850.t1hypothetical protein

Sequence
1464 bases(100 bases per row)
CACAAGTGCTCGGGGCACTTTATGCTCTGGGATGATCATCTCCTGCCTGCATGGTCCTGAAGCGAGCTCTCGCTCTAGCTCCTTGATTGAATTCATACAG
GAGAGCACCACAACTCAGTTGCGAAACTGGTAACCATTCTGGTTCTTCATAGCCCTTCCATTTCACGAGATACTCTCGTGTGCGTCGTGCAGTTCGAGTG
CGTTTATTCCAACGCAGATCCAGAATTTTCTCAACTTCAAACTCGTCGTTCAGATTGTCTGCCTCCCAGCTGTCCTCGGGTAACAAAGCGGTGTCAAAAT
CATCATCCTCGTCCAACTCGATTGCTTCAACTGGACGTTTCGGGAACAAAGCTCTCGGTTTCAGGCGACTCACATGCACCCAAGGGTTGACCCGATATCC
AGTGTTGGTGACTCTCAGCTTGACTCTGAAATCATCATGCATCTCATCTATCCTGAACGGACCATGCCACATATGAGCCAACTTCCTGCTCAAACCAGTC
TGCACCTTGGGGATGTATAGCCATACAGCATCGCCAACCTTGAAACCGGCTTTGAGACGCTCTGACAACTCCTTCCATTTCTCCGTCTGAGCTTCTGAGC
GCTGTCGTTTCGCCTTTATCTGAAGGTCTTTGGCACAGGCCTGGGCGTAGCTATAGTCACGTTGTAACTTCCGACGCCATTCGTAAGCGGTACGTTCAAC
AACGCCTGAAGGTTTGGGTCCAAGCATTGCTGACACCGTCCCTTGAGCATCCCAACCATGCACCAAGTAAAATGGTGTATCTAACCGGGTGGCGTCAAAA
GACGTGTTCAGGGCAAACATCAAACGTTCAGCGTGATCGTCCCAGTCGCTTTGATCTGATTCAGCCACGTAAGCACGGACACTTCGCATTACCGTTTGGA
CCGACCGCTCTTGCTGGCCGTTAGCTTGAGGTCGATATGCTAGGGTTGCTCGTTGCCTGCTACCCAGCATTTCCCGGAATCGGTAAAAACTTCACTCATG
AACCTTGGATCCTGGTCATGCCTCAGCATTGAACTTGCTCCGAAACGCCTGAACACACATTCCTCGTAAGCCTCAGCAACTTCTTGGGCAGTGGTCGAAC
TCATGGGCTTGCACATCACGTAGCCTGAAAATGAATCCTGAAACAGGAGCAGAAAAGTATTCCCGCGTTCAGATTTGGGCATATGGGTGACAAAGTCCAT
TGACACTAGCTCAAACGGGCGCTGAGGTTCGATATTTCCAGGTGAAGGTCCAGAATTAGGAGGTCGTCCCTTGGCCGACGCACAATCAGTGCACTCTTTG
ACAAAAATCTCCACATCAGCGAACATACCTGGCCAATAAAACTCTGCACACAATCGTTGATACGTGCGAGTTATGCCTTGATGCCCACCTTGAAAATCCT
CGTGCACATAGTGCAACATGTCTGGACGCAAGCTTTCAGGAACAACTAATCTCAGCTCAGACTC