Description :
From Genome Similarity Track
Location :
scaffold_2:159511- 161564
Transcript NameFunction/comments
g1038.t1 hypothetical protein PHYSODRAFT_558773

Sequence
2053 bases(100 bases per row)
GTACGGCCAAGACCTGATCGCGCTGGCTGAGGCTGGCAAAATCGACCCTGTCATTGGTCGAGATGAAGAGATCCGACGCGTGATCCGTATCCTGTCGCGA
CGAACCAAGAACAACCCCGTGCTGATCGGCGAGCCCGGTGTTGGTAAGACTGCCATCGTGGAAGGATTGGCGCATCGTATCGTGGTGGGCGATGTGCCCG
AGTCGCTCAACTGCAAACTAATCAGTCTGGATATGGGCGCGCTGATCGCTGGTGCCAAGTACCGCGGCGAGTTCGAGGAACGTCTGAAGGCTGTGCTGAA
GGAGGTGAAGGACAGCGACGGCAAGATCATCCTGTTCATCGATGAAATGCACCTGATTCTCGGCGCTGGTCAAACGTCAGGAGCTATGGATGCGGCCAAT
CTGCTGAAGCCAATGCTCGCGCGAGGAGAGCTGCGCTGTATCGGTGCGACGACGCTCGATGAGTACCGTCAGCACGTGGAGAAGGACAAGGCATTTGAGC
GTCGTTTCCAGCAGGTGCTAGTGAAGGAGCCGTCGGTCCCAGACACGGTGAGCATTCTGCGAGGCCTAAAGGAGCGGTACGAGTCACACCACGGTGTGCA
GATCCTGGATGCGGCTCTGGTGGCTGCTGCCAAGCTTGCAGACCGCTACATCAAAGAGCGATACATGCCCGATAAGGCTATCGATATCATCGATGAAGCA
TGTGCCAACGTGCGTGTCCAATTGGACAGTCAACCTGAAGTCATCGATGAACTGGAGCGCCGTCAGCTGCAGCTTCAGGTCGAGGCCACTGCTCTTGCGA
AGGAAAAGGATGAAATGAGCAAACAGCGTCTGAAAAAGGTGCAGGAGGAACTGAACACGATTCAAGACGAGCTGAGCCCGCTGATCCTGCGTCACGAGGC
TGAGAAGGCTCGTGTGAACGAAATCCGCCAACTTCGCGATAAGTTGCAGCACCTGCAGCTGAAGGCAGAGCAGGCGGAACGTAACCAAGATCTACAGACC
GCATCCGATCTGCAGTACTATGCCATTCCCGATGTTCGACGCCGGATCGCCTCTGCGGAGGAGGCTAAGAAGCGCGAAGACGAAGATGAAACCCAGCACA
AGATGGTCGAGGAGGTCGTGCGCGAAGACCAGATCTGCGAGGTGGTGGCTCGCTGGACGGGCATCCCGGTGTCTCGGCTGACGTCGAGCATGGGCGACCG
TCTCATGCATTTGGAGGAACGCATCCACAAGCGCGTGGTTGGACAGGAGGAAGCCGTGAAAGCTGTGTGCGACGCCGTACTCCGCTCGCGTGCAGGTCTT
GCTCGATCGGGACAACCGACTGGCAGCTTCCTCTTCCTAGGCCCGACTGGTGTGGGGAAGACGGAACTAGCCAAGGCGCTGGCGTACGAGCTCTTCGACG
ATGACAAGCACATGGTGCGAATCGACATGAGCGAGTACATGGAAGAGCACACTGTCTCGCGTTTGATCGGGGCCCCCGCCGGATATGTTGGCTTTGACTC
TGCACCGGGGCAGCTAACGGAGGCTGTACGCCGCAACCCGTACAACGTGATCCTGATGGACGAGATCGAGAAGGCCCACCCGAAGGTTTTGAACATTTTG
CTGCAAGTGCTCGATGATGGGCGTTTGACGGACTCTCACGGACGCACGGTCGACTTCGCCAACACGGTGGTTATCATGACGTCGAACATTGGCGCTGAGC
ATCTTCTCTTCGAGAACGACTTCGCGTCTCGTGCCAGCAAGAAAATCAAGACGGAGAACGACTTTGTCGAGTCCGAGAGTGACACCAAGAAGGAGTTCGC
GAAGCAGCGCGAGTTGGTGCTGCAGCAGCTGCGTCACACGATTCGTCCGGAGCTGCTGAACCGTCTGGACGACATTGTCGTGTTCGAGCCACTGGGCCGC
AAGGAGCTGCGTCAGATCGTGCTGCTGCAGTTCGAATCCGTCATTAGCCGCCTGAAGGAGGCGCAGATCTCGGTTAACGTGACGACGAGCGCGCTGGACG
TGATCTTGGACGAGTCGTACGAGCCGCAGTACGGCGCGCGTCCTATCAAGCGG