Description :
From Genome Similarity Track
Location :
Scaffold_44:1595- 2800
Sequence
1205 bases(100 bases per row)
ATCCGGAGGTACGCGTCAAGACGTTCAGCGTCTCGACGTCCGGCTTCTCAGCCTCGGTCTGCCCAGCAGACATTTCTTGTAGCGTCTCGGCCCAGGCCGA
GACTTGCGCAGCGGTCTTCGCATGCGCCGTCTTTTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTTTT
CTTCTTCAGTACCGCCGGCGGGTACATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTAGAACGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCA
TGCAAGTTTTTTTTTCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGACTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTA
TAGGCGGAGACCCTTTCGGGGCTGTTGTCCTTTTCGATGCCTTCGCAGGTCTTCCTTGGTCGTGTTTGCCGCCTCCAATGACGGTGTCGTCGACAGTTGA
GAAGCGAAGGACACACTGGCCAAACAGACAACTCCGGTGGATCTTGGATCTGCACTTGAAGGTAGTTCACTAGGAAGGTTTCGGATCTGGCCAATATATT
ACTCCAGTCTTACAACCAACACCAGCTCTACTACCGCTAACCTCTCTACGCCGTGTAAGGCCAATGTCGTTCCCGTTTCCAGGCGAGGGAGGAAACGCTT
GCGATGTACAAGGCAAATTCGGTTCTGATTTATGCTTAAGTTCGTTCTATCTCAAAGTCCTATCACCATGTGGATCCTATCATCCCATCTGTGCTTACCG
ACTCTATGGGCTCCCATTATCTTCATTGCGTGTCAGCTGCTTGCCCGTCGAGTCGTGTCCACAGCTTCCTGATTACGCCTGAATTCAGAACCACGTTGGA
CCTTGGATCTTGCATCCTGGATCCACCTGAGTCCAGATCCAGATCCATCTCAGTCTGGATCCAGCGCAGATCCAGATCCATCTCAGTCTGGATCCAGTGC
AGATCAAGATTCATGTCGGATCTTGGATCCTGGATCCACCCGAGTCTAGATCCAGATCCACACGTTGGATTTGCGTCCTTTCACTGTCACTCTTCCGGAT
TTGTGCCGAGGTCCAGATCCGTCACTCGTCTCATCACTGCTATAACTCTTCTCCGGGAATTGCGCTTCTCCACAATCGCCTCCTGACCGTAGTTGACGCC
GATCA