Description :
From Genome Similarity Track
Location :
contig_15:159482- 161883
Transcript NameFunction/comments
g4173.t1hypothetical protein
g4174.t1XP_009516883.1 hypothetical protein PHYSODRAFT_471625 [Phytophthora sojae

Sequence
2401 bases(100 bases per row)
GCTGATGTTTGTAGTGCGACTTGAGCGCTTGGATCTTCAAGCGGTGGTATGTGGTCAGAAACCAAACGAGGTGGAAATACTGAAGTCGATCTGTCGAGAT
CAATTTTTGGCTCCCTCTGCGAAACTCGGTCTTCAATGACGTCGTGAGCTGGAAATATGATTTGGCAACGATAGAGTCGCAGATCTCCTGCAGAACCTTC
ATCGTACGTCTGCGGTCACACAAGCGAATAAAGGTTAGTGCTCGCTCAGTTGGTTCACGCACCCTTACGCGAGAACTTACTCATCGGATTCGGTCACCCT
CCCTTTGCCGCCAAAAACCTCGTGAATATCGGTGACCGGGGCTGCACTCTTCTTTCCTCTCCTCCGGGAGACCGGCTTCTTGGCTGCCTGTGGGACCTGG
TCGTACACTGTTTTGGAGAAGTCCGACACCACTGTCGCCCGCCCAGTGGGGCCGACCATCTTCATGATCCCACCGAAGTTGGAATGGCGATGTGATCCAG
ACTGGTGCAGAGCCGACGCCTTCTTCTCGCTGTCCAGCTTCGCAAGCAGATTCCCACCTGCAGACGCAGCATTCCGAGCTCCTGACGGCGTGGTCGTCGC
AGCTGCCTGTCCACTCGAGCTGCTCGACGTTTTCCCCGTCAGCTGGTTCTTCGCGTATGCCACCACGCACTTGGGCTGGGAGCAGTCCAGCGTCAAGTCG
ATCATCTCCATGATGAGCAAGTTCCACTCCCTGTTCTCCGGCGCCTCGATATCCTGCGTAAACAGCAAGATCATCTCGTACACGTTCTCGTCGTGCAGCG
TGCAGATAAAGTCCTCCTGCAAGTGGCTGAAGTAGGACGTGGTGGACGTGACGAACCGCGGGTCCTCGTTCGGGATCGCCAGCAGGTTGCGCAGCAGCGT
GAGCACGATTTCCATGTTGAGAAAGTCCTGCGGCGTGCGCGCCGAGCCCTTGCGGGACAGCGGCTCCACGAGGATCGTCATCATGATGGGGACCACGCCG
CAGCGCAGGAACTCGTGCTTGTACTGCCTCAGGTACTTGAGTTGCTGGGCGATGTTGGTGGAGTCTCGTGGGGGCTTCGTCGTGAGCATCACGAGCACCT
TGAGGATGGAAAACACGAGCTTCCAGTCGTGCTGGTGGTGCACGAGCAGCGGCAGCAGCTTCTTCTGCAGGATCTTCCACTTGCCCAGCTGCTTGGTCAC
CAGTCGGTGCTTGGCGTGGTCGCGGCGCACGGCGCGCTGCAGGTCGTGCACCCAATCGTCGCAGTTCTCGCCGCGCAGGAGCACAGGCGCCTCGCCCTCG
GTCTGCACGCGCAGCATGCCCAGGTTGGAGCACACGAGCAGCAGCTCGTTCATCATGTCGGCGTCCAGCGCGGGATCGTTCCCGTCCTTGTCTTCGTCGG
ACGAGGACATGGCGAAGTCCTCCAGCTCCTCATCGCGCTGGACAGTGGCGTCGGACGTGTCCGCCATTATTCCTAATGGCTCACTTTAGCTACTGGCGCC
AAAAAGCGGCGCGAGAGTGATTGTCGTATACACTAAGTGCGATTGGAGTCCGAGCCTCAGTTTAATCTTCACAGGATGGAAGCGCTCGCAGGACCGCTGC
CTATGGAGCCGCAGGCGCAGGACGCACAGGATCAACCGATGCAGGACGCACAGCCTCAGGACCAGACCGCGCAGGGCCAACAGCAGCAGAGCTTCGCGTC
CTCCGGCTACGACAACGCGATGCAGTTCCAGCAGCAGTCACAGGCCCAGCCGCAGCAGTTCCAGTCTCCGCCCCAGCAGTATCAGCAGCCCCAGCAGCAG
TCCCAGCAGCAGCCCCAGCAGCAGCCCCAGCAGCAAGCCATGTACAACTCGCAGGCCCAGCAGATGAACGCCTACAACCTCAAGGCGCCGCCCGCATGGC
GTTTGGTGCCTCGTCCGCCGCCGTGGAGGAGCGTGCCACGCACCTGCTGGCCGCATGTGAGTCCTGCCTCGTAGTTACGCGCGTGCCGGGCGTGGACTTG
TCGTTCCGCCGCATCATGGAGCGCAAGTGTCCGCGCTGCGGCGGCACGCTGGTGCTTCCCCAGGAGGTCATGGAGATGCTCATCCTCTACGGCAACTTCG
TGCCCGAGTCGGCGGCCGTCACGCTCGTGCTGGGCACCATGGTGCTGCACCCGTCTCTGCGCGCGGACTTCATGGCGGCGGCGATGAACGAGCTGCTCAT
CCCGTTGCAGACGGACTTTGTCTATGATGTGGCGGTGCCCAAGCGCCCAGAAGGACTGGGCATGTCGCTGCGCATGCACCGTGAGCGCCTTACCGAGTGA
TATGGGGGATTCCTGTGGATGATTTTGACGTTATGTGGCTGTGTGTTTTGTTTGCAGAGGGAAACCTCGTGGTTGGCGGCTTCATCGATTTTGAGAACAA
C