Description :
From Genome Similarity Track
Location :
Scaffold_652:15944- 17185
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-snap-gene-0.5Sodium/hydrogen exchanger

Sequence
1241 bases(100 bases per row)
TCATGTCCAGGAAGCGGGCGAGCGGCACGGGGCTGGACCCGCAGATCCTCTTCTTCGGACTGCTGCCGCCGATCATCCTTGAAGCGGGCTTCAACACGCA
GCGCAAGGGTTTCTTCTCCAACTTCTCGGCGATTCTGCTACTCGCGCTCCTGGGCACGATCGTAGCGACGGTCGCGACAGCCGGTGGTTTACTCTGGCTC
GGCCGTCGTTTTGACTTTGTCACGGAGCTCAAGCCCGCCGAGGCGCTGTTGTACGGCTCGCTCATCTCTGCGATCGACCCGGTGTCGACGCTGGTCGTGC
TTAAAAAGAGTCGCGCGCCGAGCCTCCTGTTCAACCTGCTCTTTGGTGAGAGCGTGCTCAACGACGCCGTGTCGATCGTGATCTCGGGGCTCTTCCAGCA
ATCCGTCCTGGAAAAGAACGATTCTCCACTCACATGGCGATCCGCAAGCGAGCTGGCGGGCCAGCTCATCGGTATCGGTGTGAGCTCCGTGGCGCTCTCG
GCGACGATTTGCTTGGCGTCTGCGTTCATCCTCAAGGTACCGTGTCCTTTGGTTCTGCATGAGCTCATTAAGCTCCATACTAACAGTGACTGCGTGCCTG
TGTTGATAGCACTCGGACGCCGCGATGAAGCATTACCCGACGTACGAGACCTCGGTGATTCTGCTGTCGGCGTACGCGAGCTTCGTCGCGGGCGAGGGCT
TCGAGCTCAGCGGCCTACTCTCCGTATTCTTCAGCGGCGTGTTCATTCGGCATTATCACATGTACAATATCTCCAAGGCGAGCGCCGCCACGTTCACACA
CTTGCTATCAACGCTCGCGTTCCTGGCCGAGAACTTTATCTACACGTACCTTGGGGTCAGCGTGCTCGCATGTAAGTGCTTACTATCACCGTACTGTCTG
TAGCTGTCTAGTCATTCGTATGAGGATGCTGACCCACCCACCTTGCCGTGTGTCGTAGTCTCCAACTTGTTCAAGTGGGACTGGGGCTTCATCGGCGCGA
GCTTTGGCGTGTGTCTCGTGGCGCGAGCGCTCAACACGTTCCCGTTGTGCGCACTCGCGAACCTCTGTCGGCGACAGGACCAGCGGATCCCTGTCACGTA
CATGACGGTGATCTGGTTCTCGGGCCTGCGCGGCTCGATCGCGTTCGCGCTCGCGCTCAACGTGCGCGTCTCGGGAGACTCGAATCACGCCGATATCCTG
CGAGCCTCGACGCTCTTCACCGTGCTCTCGACCACCATCGT